Lithophragma heterophyllum

(Hook. & Arn.) Torr. & A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Saxifragaceae/Lithophragma

At a glance

Occurrence records3 244

Data sources10

Biological traits12

DNA specimens4

eDNA detections2

Sources10 archives

Databases and archives Lithophragma heterophyllum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 244 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF3 244 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Lithophragma heterophyllum, commonly known as hillside woodland star, is a species of flowering plant in the saxifrage family found in the western United States. It is native to the coastal mountain ranges of California, where it can generally be found in shady habitat. It is a rhizomatous perennial herb growing erect or leaning with a slender naked flowering stem. The leaves are located on the lower part of the stem, each divided into rounded lobes. The stem bears 3 to 12 flowers, each in a cuplike calyx of red or green sepals. The five petals are white, up to 1.2 centimeters long, and usually divided into about three pointed lobes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.024 mg

Seed mass max0.024 mg

Seed mass min0.024 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lithophragma heterophyllum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAB292033.1 ↗652 bpUSA · 1988

ACGT

TCGAAACCTGCATGGCAGAACAACTTGTGGACATGTAGTTAAACTTGGGGGGGAGGGAGTGCAAGCTCGCTCTCCCCCGTGGTCAATGTG …

Lithophragma heterophyllum genes for ITS1, 5.8S rRNA, ITS2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Lithophragma heterophyllum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 142×CCDB · book-ipcn65 · CCDB · eflora

CCDB · book-ipcn65 — Taylor 1965

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 244 records

Wild obs. + sensor2 944

Museum / vouchered300

Origin

Native36

Range

Area of Occupancy AOO3 268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 1 834≤1 km 260≤10 km 101>10 km 51

2 246 georeferenced · 698 without coordinates

Open the mapobservation + sensor2 944

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 4≤1 km 68≤10 km 70>10 km 2

144 georeferenced · 156 without coordinates

Open the institutions mapphysical evidence300

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	39
Angwin, US	38
Riverside, US	27
San Luis Obispo, US	23
Davis, US	20
Santa Barbara, US	17
Pullman, US	15
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	13
Canadian Department of Agriculturelocation not on record	11
CASlocation not on record	9
EL PASO, US	4
Bloomington, US	3
Santa Cruz, US	3
Cheney, US	3
Henderson, US	1
Chongqing Museumlocation not on record	1
Bangkok, TH	1
WTUlocation not on record	1
San Angelo, US	1
Auckland, NZ	1
Boise, US	1
Phoenix, US	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Victoria, CA	1
ASUlocation not on record	1

25 institutions · 236 of 300 vouchered records shown · 64 without an institution code

09Environmental DNA2 detections

Where the DNA of Lithophragma heterophyllum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Coast live oak (Quercus agrifolia) woodland;…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 12.9–12.9

Seasonal swing summer↔winter14.9 °C

Max temp (day)20.2 °C

Min temp (night)6.50 °C

Precipitation46.0 mm/mo

Air humidity55.6 %

Moisture balance-83.8 mm/mo

Vapour deficit665 Pa

Wind speed3.80 m/s

Cloud cover30.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Lithophragma heterophyllum

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 244 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 244 records