Lithocarpus formosanus

(Skan) Hayata · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fagales/Fagaceae/Lithocarpus

At a glance

Occurrence records22

Data sources5

Biological traits25

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Lithocarpus formosanus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility22 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF22 records

DNA & barcodingNCBIsequences

01Narrative

Lithocarpus formosanus (Skan) Hayata – gatunek roślin z rodziny bukowatych. Występuje naturalnie na Tajwanie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length13 mm

Fruit length max13 mm

Fruit length min13 mm

Fruit width16 mm

Fruit width max16 mm

Fruit width min16 mm

Leaf length65 mm

Leaf length max80 mm

Leaf length min50 mm

Leaf width25 mm

Leaf width max30 mm

Leaf width min20 mm

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatewet tropical

Climberself-supporting

Elevation max500 m

Elevation mean300 m

Elevation min100 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lithocarpus formosanus has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ685173.1 ↗397 bp

ACGT

AAACCGAACCCCGTCACGAAATGCGCCAAGGAAATCGAACCAAGAAAGCCACGTCGGAGGCCCCAAACATGATGCGCCCTTGGTGTTGGC …

Lithocarpus formosanus strain FuLfor internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type22 records

Wild obs. + sensor5

Museum / vouchered17

Origin

Native7

Range

Area of Occupancy AOO60 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 5

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 2

5 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TAIElocation not on record	7
Taipei, TW	4
Guangzhou, CN	2
Beijing, CN	1
Taipei, TW	1
University of Stellenboschlocation not on record	1
Taipei, TW	1

7 institutions · 17 of 17 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)