Lithocarpus dodonaeifolius

(Hayata) Hayata · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fagales/Fagaceae/Lithocarpus

At a glance

Occurrence records56

Data sources6

Biological traits20

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Lithocarpus dodonaeifolius's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility56 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF56 records

DNA & barcodingNCBIsequences

01Narrative

Lithocarpus dodonaeifolius is a species of tree in the family Fagaceae. L. dodonaeifolius is a medium-sized tree, up to 9 m tall. It is endemic to Taiwan and only occurs in the Hengchun Peninsula in the extreme south of the country. It grows in mixed mesophytic forests at altitudes of 500 -. Lithocarpus dodonaeifolius is similar to L. formosanus, and their identity as separate species has been questioned. Molecular genetic methods suggest that they are closely related but distinct species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Fruit length12.5 mm

Fruit length max15 mm

Fruit length min10 mm

Fruit width12 mm

Fruit width max14 mm

Fruit width min10 mm

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatewet tropical

Climberself-supporting

Elevation max1 450 m

Elevation mean975 m

Elevation min500 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lithocarpus dodonaeifolius has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

ITSKJ685170.1 ↗396 bp

ACGT

AAATCGAACCCCAATGCAAAACACGCCAAGAAAATCGAACCAAGAGAGCCACGCTGGAGGCCCCGGACAAGGTGCGCCCCCGGCGTCGGC …

Lithocarpus dodonaeifolius strain FuLdod internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type56 records

Wild obs. + sensor44

Museum / vouchered12

Origin

Native6

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 44

44 georeferenced

Open the mapobservation + sensor44

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 5

7 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TAIElocation not on record	7
Taipei, TW	4
Taipei, TW	1

3 institutions · 12 of 12 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)