Listrostachys pertusa

(Lindl.) Rchb.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Listrostachys

At a glance

Occurrence records203

Data sources9

Biological traits11

DNA specimens5

eDNA detections4

Sources9 archives

Databases and archives Listrostachys pertusa's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility203 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF203 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 46

01Narrative

Listrostachys is a genus of flowering plants from the orchid family, Orchidaceae. Many species have been placed in the genus over the years, most of them now transferred to other groups. At present (June 2014), only one species remains in the genus: Listrostachys pertusa. It is native to tropical Africa from Sierra Leone to Congo-Kinshasa.Kew World Checklist of Selected Plant Families

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formepiphytic subshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTdense forest

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Listrostachys pertusa has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences9

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMH237084.1 ↗336 bpCameroon · 2011

ACGT

AACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAACATACCGAGCGATTCGGAGAACCCGTGAAACAAGCGGCG …

Listrostachys pertusa isolate 2345 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Listrostachys pertusa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 46 n = 23

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 461×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Burg, W. J. V. & F. M. V. Laan. 1980. Notes on African Orchids. Belmontia. 11: 23–36.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type203 records

Wild obs. + sensor4

Museum / vouchered199

Range

Area of Occupancy AOO396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 2 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 199 records without

Open the institutions mapphysical evidence199

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	19
LBVlocation not on record	19
BRLUlocation not on record	16
Herbier National du Gabonlocation not on record	9
WAGlocation not on record	8
MeiseBGlocation not on record	8
Yaoundé, CM	7
Plocation not on record	5
Paris, FR	4
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	4
CNF-UFHBlocation not on record	4
Forest Herbarium Ibadan (FHI)location not on record	3
IPHAMETRAlocation not on record	2
Bronx, US	1
MAlocation not on record	1

15 institutions · 110 of 199 vouchered records shown · 89 without an institution code

09Environmental DNA4 detections

Where the DNA of Listrostachys pertusa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)