Lissanthe strigosa

(Sm.) R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ericaceae/Lissanthe

At a glance

Occurrence records7 798

Data sources8

Biological traits47

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Lissanthe strigosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 798 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources47 traits

Occurrence & distributionGBIF7 798 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Lissanthe strigosa là một loài thực vật có hoa trong họ Thạch nam. Loài này được (Sm.) R. Br. mô tả khoa học đầu tiên năm 1810.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology19

Fruit length2.7 mm

Leaf length13 mm

Leaf length max16.5 mm

Leaf length min3.4 mm

Leaf mass7 mg

Leaf mass per area388 g/m2

Leaf size17.25 mm²

Leaf width1.55 mm

Leaf width max2.2 mm

Leaf width min0.5 mm

Petiole length0.09 cm

Plant height0.7 m

⚠ sources differ — AusTraits: 0.7 m · TRY: 0.3 m

Plant height max1 m

Plant height min0.1 m

Seed length3 mm

Seed mass1.4 mg

⚠ sources differ — AusTraits: 1.4 mg · GIFT: 19.36 mg

Seed mass max19.36 mg

Seed mass min19.36 mg

Seed width2.25 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal

Flowering endNov

Flowering startAug

Flowering timennnnnnnnynnn

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapelanceolate linear

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio36.97 g/g

Leaf c510 mg/g

Leaf n13.8 mg/g

Leaf p0.34 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)2.59 mm²/mg

Wood density668 mg/cm³

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lissanthe strigosa has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences4

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKC197101.1 ↗643 bpAustralia

ACGT

TCGAAAGACCGCCAAGCAAAAAGACCCGCGAACTTGTCTCCACGTACTATTGGGAGTGATGTGATGGTTGCGGACTTTTTGCGTAGCCTT …

Lissanthe strigosa subsp. subulata isolate 443 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Lissanthe strigosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Chromosome records14–142n range14median14mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 142×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Smith-White 1948b, 1959a lo

CCDB · book-atlas-flowering-plants

n 71×CCDB · Cave1959

CCDB · Cave1959 — Smith-White 1959a

08Occurrence & distribution

Record type7 798 records

Wild obs. + sensor7 547

Museum / vouchered247

Other4

Origin

Native49

Range

Area of Occupancy AOO15 100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 6 490≤1 km 507≤10 km 137>10 km 57

7 191 georeferenced · 356 without coordinates

Open the mapobservation + sensor7 547

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 49≤1 km 32≤10 km 43>10 km 2

126 georeferenced · 121 without coordinates

Open the institutions mapphysical evidence247

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Armidale, AU	61
Mount Annan, AU	49
NSW Dept of Planning, Industry and Environmentlocation not on record	38
Museo Entomologico de Leonlocation not on record	33
Wollongong, AU	12
QVMAGlocation not on record	10
Brisbane, AU	5
La Trobe Universitylocation not on record	5
Canberra, AU	5
Parkville, AU	4
Kew, GB	4
Adelaide, AU	4
Batemans Bay, AU	4
NSW Office of Environment and Heritagelocation not on record	2
South Kensington, GB	2
Stockholm, SE	1
Hobart, AU	1
Kensington, AU	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Saint Louis, US	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Guangzhou, CN	1
Cambridge University Herbariumlocation not on record	1

23 institutions · 246 of 247 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Lissanthe strigosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 21.6–21.6

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.2 °C

Min temp (night)15.0 °C

Precipitation9.20 mm/mo

Air humidity43.9 %

Moisture balance-124 mm/mo

Vapour deficit1,452 Pa

Wind speed3.70 m/s

Cloud cover17.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Lissanthe strigosa

At a glance

Sources8 archives

Size & morphology19

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry8

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type7 798 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 798 records