Lispe pygmaea

(Fallén, 1825) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Muscidae/Lispe

At a glance

Occurrence records370

Data sources7

Biological traits1

DNA specimens93

eDNA detections118

Sources7 archives

Databases and archives Lispe pygmaea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility370 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI118 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics93 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF370 records

Environmental DNA3 datasets · 16 countries118 detections

DNA & barcodingBOLD93 specimens

01Narrative

Lispe pygmaea is a fly from the family Muscidae. It is found in the Palearctic .Fauna Europaea

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (larval)predator

05DNA & barcoding93 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lispe pygmaea has left across the world's sequence archives.

At a glance

DNA specimens93

BINs2

Marker genes2

eDNA detections118

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus83 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

134Cmostly conserved

182Gvariable

200Tmostly conserved

210Cmostly conserved

218Cmostly conserved

302Gmostly conserved

362Tmostly conserved

506Amostly conserved

545Tmostly conserved

546Cmostly conserved

576Tmostly conserved

608Cmostly conserved

644Cmostly conserved

CATTATATTTCATTTTTGGTATTTGATCAGGTATACTAGGAACTTCTTTTAGAATTTTAATTCGTACTGAATTAGGTCATCCTGGAGCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.87%

Haplotypes28

BINs2

Most divergent pair2.4%

EuropeOtherAsiaN.AmericaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lispe albimaculatasame genus8.4%Lispe assimilissame genus9.0%Lispe albitarsissame genus9.2%Lispe uliginosasame genus10.1%Lispe nasonisame genus10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type370 records

Wild obs. + sensor224

Museum / vouchered146

Range

Area of Occupancy AOO828 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 127≤1 km 48≤10 km 44>10 km 2

221 georeferenced · 3 without coordinates

Open the mapobservation + sensor224

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 107≤1 km 7≤10 km 10

124 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence146

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	14
Helsinki, FI	10
University of Tokyo, Department of Zoologylocation not on record	5
KwaZulu-Natal Museumlocation not on record	4
MZLUlocation not on record	4
Metsähallituslocation not on record	2
ZMAAlocation not on record	2
CBDClocation not on record	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
DFFW2016location not on record	1
Wellcome Sanger Institutelocation not on record	1
Copenhagen, DK	1

12 institutions · 46 of 146 vouchered records shown · 100 without an institution code

09Environmental DNA118 detections

Where the DNA of Lispe pygmaea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found118

Studies independent surveys3

Countries16

Verifiable raw sequence linked29

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 118 detections have coordinates

Open the map16 countries0

14. Artificial - Terrestrial|14.5 Urban AreasUrban1. Forest|1.4. Forest - TemperateMediterranean forest8. Desert | 8.1. Hot Desert1.1. Boreal Forest|1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 8.80–20.6

Seasonal swing summer↔winter16.9 °C

Max temp (day)18.4 °C 12.4–25.0

Min temp (night)11.6 °C 4.20–15.8

Precipitation60.6 mm/mo 41.6–188

Air humidity60.6 % 56.5–63.3

Moisture balance-50.6 mm/mo -85.8–136

Vapour deficit673 Pa 422–1,116

Wind speed4.00 m/s 2.10–6.40

Cloud cover41.8 % 29.7–49.6

CHELSA 1981–2010, ~9 km grid, at location & month of 116 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)