Lipoptena cervi

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Hippoboscidae/Lipoptena

At a glance

Occurrence records8 473

Data sources7

Biological traits0

DNA specimens143

eDNA detections212

Sources7 archives

Databases and archives Lipoptena cervi's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 473 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI212 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics143 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF8 473 records

Environmental DNA3 datasets · 9 countries212 detections

DNA & barcodingBOLD143 specimens

01Narrative

Lipoptena cervi, the deer ked or deer fly, is a species of biting fly in the family of louse flies, Hippoboscidae. These flies are commonly encountered in temperate areas of Europe, Siberia, and northern China. They have been introduced to North America.Fact Sheets. Deer Keds. Department of Entomology, Pennsylvania State University. Retrieved 2015-09-26. They are parasites of elk, deer, and other deer family members, burrowing through the fur and sucking the blood of the host animals. Adults are only 5 - in length and brownish in colour. Their bodies are flat and elastic, making their removal difficult. L. cervi is a poor flier and can only fly for short distances. Once the insect reaches its target, it sheds its wings and starts burrowing through the fur.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding143 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lipoptena cervi has left across the world's sequence archives.

At a glance

DNA specimens143

BINs1

Marker genes1

eDNA detections212

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus140 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

78Cmostly conserved

267Cmostly conserved

279Amostly conserved

312Gmostly conserved

339Tmostly conserved

396Amostly conserved

408Amostly conserved

447Amostly conserved

495Amostly conserved

525Tmostly conserved

537Amostly conserved

579Gmostly conserved

627Gmostly conserved

TTATATTTTATTTTTGGAGCTTGATCAGGAATAATTGGAACTTCATTAAGAATTTTAATTCGATCAGAATTAGGTCACCCTGGATCATTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.46%

Haplotypes17

BIN1

Most divergent pair2.1%

EuropeN.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lipoptena fortisetosasame genus7.1%Hippobosca longipennissame family9.9%Ligeria angusticornissame order11.6%Hydrotaea militarissame order11.6%Helina vicinasame order11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type8 473 records

Wild obs. + sensor7 191

Museum / vouchered1 280

Fossil2

Range

Area of Occupancy AOO21 380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 3 191≤1 km 1 703≤10 km 1 477>10 km 155

6 526 georeferenced · 665 without coordinates

Open the mapobservation + sensor7 191

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 665≤1 km 202≤10 km 159>10 km 32

1 058 georeferenced · 222 without coordinates

Open the institutions mapphysical evidence1 280

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	152
Helsinki, FI	134
Gothenburg, SE	63
Oulu, FI	55
University of Tokyo, Department of Zoologylocation not on record	48
SLU Artdatabankenlocation not on record	41
Philadelphia, US	17
Tilburg, NL	16
BioFokuslocation not on record	15
Bavarian State Collection of Zoologylocation not on record	11
South Kensington, GB	10
NHMOlocation not on record	7
University Park, US	6
Stockholm, SE	5
neflocation not on record	4
University of Alberta Museums (UAM)location not on record	4
MZLUlocation not on record	4
KwaZulu-Natal Museumlocation not on record	3
NCMGlocation not on record	3
SOVTlocation not on record	3
Bonn, DE	2
Blacksburg, US	2
Cornell University Insect Collectionlocation not on record	2
Rovaniemi, FI	1
SGAV-and-NHMDlocation not on record	1
Cambridge, US	1
Provincia di Livornolocation not on record	1
Natural History Museum, Londonlocation not on record	1
New Haven, US	1
OSUClocation not on record	1
Kuopio, FI	1
ZMAAlocation not on record	1

32 institutions · 616 of 1 280 vouchered records shown · 664 without an institution code

09Environmental DNA212 detections

Where the DNA of Lipoptena cervi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found212

Studies independent surveys3

Countries9

Verifiable raw sequence linked34

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 212 detections have coordinates

Open the map9 countries0

On various birds

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.8 °C 2.00–15.1

Seasonal swing summer↔winter19.4 °C

Max temp (day)14.5 °C 6.40–18.2

Min temp (night)7.60 °C -2.40–11.8

Precipitation75.8 mm/mo 60.6–137

Air humidity62.6 % 62.3–66.2

Moisture balance22.2 mm/mo 3.80–97.8

Vapour deficit486 Pa 253–630

Wind speed2.80 m/s 2.00–4.50

Cloud cover46.3 % 45.1–56.5

CHELSA 1981–2010, ~9 km grid, at location & month of 118 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Lipoptena cervi

At a glance

Sources7 archives

At a glance

Record type8 473 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 473 records