Liparis nervosa
(Thunb.) Lindl. · speciesAt a glance
Occurrence records2 253
Data sources12
Biological traits16
DNA specimens32
eDNA detections31
Sources12 archives
Databases and archives Liparis nervosa's data was compiled from.
WikipediaWikimedia Foundation6 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility2 253 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics32 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources16 traits
Chemical compositionNPASS17 compounds
Occurrence & distributionGBIF2 253 records
Environmental DNA1 datasets · 2 countries31 detections
DNA & barcodingBOLD · NCBI32 specimens
Genome at a glanceCCDB2n = 42
01Narrative
Liparis nervosa is a species of orchid found in the Tropics of Asia, Africa and America. It is a terrestrial species that grows in woodlands and grasslands.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology2
Plant height0.6 m
Plant height min0.2 m
Life cycle & reproduction3
Life formpseudobulbous geophyte or lithophyte
Life spanperennial
Raunkiær life formcryptophyte
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 500 m
Elevation mean1 500 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTBosque alto, bosque medio
Woodinessnon-woody
03Chemical composition17 compounds
Compounds documented for Liparis nervosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Shikimic acids and derivatives $ Simple phenolic acids1
Acyclic monoterpenoids1
Documented compounds17 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| DAFPNYIDCGNPKO-DREIUISMSA-N | present | NPASS | |
| DAFPNYIDCGNPKO-RDPLUHNXSA-N | present | NPASS | |
| FQXZITIIHQHGBC-JVGHYXPNSA-N | present | NPASS | |
| Geranyl Acetate | present | NPASS | |
| ISIXBISKILQIOT-WVKQOWSQSA-N | present | NPASS | |
| LLZLNFVFAZZRDM-CKKANSGPSA-N | present | NPASS | |
| LLZLNFVFAZZRDM-SRKQRNDPSA-N | present | NPASS | |
| Nervogenic acid | present | NPASS | |
| NWWKOYHZKGDLBU-BUWNZBPXSA-N | present | NPASS | |
| OKBXKORUTBMESK-WVKQOWSQSA-N | present | NPASS |
05DNA & barcoding32 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Liparis nervosa has left across the world's sequence archives.
At a glance
DNA specimens32
Marker genes4
GenBank sequences10
eDNA detections31
Countries3
The DNA barcodea real sequence read deposited for this species
TCGAGATCAAAAATATCCTTTATCGAGTGATTCGAAAAACTCGTGAACCAAGTGTTGGCAATTGCCACAAAGAAAAATCCATCCTAGTCA …
Liparis nervosa voucher SG1233 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL1★ITS4★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Liparis nervosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 42 n = 21
Ploidypolyploid inferred
Chromosome records40–422n range42median42mode14records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4212×CCDB · iapt · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +4
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · book-ipcn65 — Tanaka 1965a
CCDB · ipcn-api-dl — Biswas, B. K. 1980b. In IOPB chromosome number reports LXVI. Taxon 29: 169.
CCDB · ipcn-api-dl — Singh, F. 1981. ln Chromosome number reports LXXII. Taxon 30: 704–705.
CCDB · ipcn-api-dl — JORAPUR, S. M. & S. N. Hedge. 1980. In Chromosome number reports LXVIII. Taxon 29:546.
CCDB · ipcn-api-dl — Burg, W. J. V. & F. M. V. Laan. 1980. Notes on African Orchids. Belmontia. 11: 23–36.
CCDB · book-ipcn67-71 — MITSUKURI, Y.' & T. KOZUKA. 1967. Cytological studies on Japanese Orchidaceae 1. Chromosome numbers and karyotypes of Liparis. La Kromosomo 68: 2221-2228.
CCDB · book-indian_vol2 — Biswas, B .K. 1980c
CCDB · book-indian_vol2 — Miduno, T. 1940; Tanaka, R. 1965b; Mitsukuri, Y. & Kozuka, T. 1967 ; Jorapur, S.M. & Hedge, S.N. 1980
CCDB · book-fedorov — Miduno 1940b
CCDB · book-fedorov — Tanaka R. 1965b
CCDB · book-atlas-flowering-plants — Miduno 1940
2n 402×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Li, X. l. & R. y. Chen. 1989. Studies on chromosomes of Orchidaceae in China I. Chromosome numbers of some orchids in China. Pp. 301--307 in D. Hong (editor), Plant Chromosome Research 1987.
CCDB · ipcn-api-dl — Li, X., R. Chen & R. Tanaka. 1992. Reports on chromosome numbers of some orchids cultivated in China. Kromosomo 67–68: 2301–2311.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type2 253 records
Wild obs. + sensor413
Museum / vouchered1 834
Other6
Origin
Native162
Range
Area of Occupancy AOO5 364 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy29% within 1 km
≤100 m 58≤1 km 27≤10 km 36>10 km 174
295 georeferenced · 118 without coordinates
Open the mapobservation + sensor413
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 10≤1 km 40≤10 km 56>10 km 14
120 georeferenced · 1 714 without coordinates
Open the institutions mapphysical evidence1 834
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions80 of 185 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Guangzhou, CN | 119 |
| Blumenau, BR | 110 |
| Kochi, JP | 103 |
| Beijing, CN | 89 |
| Bronx, US | 73 |
| Saint Louis, US | 68 |
| MeiseBGlocation not on record | 68 |
| Odawara, JP | 64 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 45 |
| Sanda, JP | 39 |
| Kunming, CN | 36 |
| Tokushima, JP | 33 |
| Tsukuba, JP | 27 |
| Paris, FR | 26 |
| Chaguaramas, TT | 25 |
| Guilin, CN | 24 |
| Forest Herbarium Ibadan (FHI)location not on record | 24 |
| South Kensington, GB | 24 |
| Kagoshima, JP | 23 |
| JBRJlocation not on record | 20 |
| BRLUlocation not on record | 20 |
| LBVlocation not on record | 20 |
| WAGlocation not on record | 19 |
| Chiba, JP | 19 |
| Salvador, BR | 19 |
| Chengdu, CN | 19 |
| UNESClocation not on record | 17 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 17 |
| Taipei, TW | 16 |
| Plocation not on record | 16 |
| UFPRlocation not on record | 16 |
| Stockholm, SE | 15 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 14 |
| Criciúma, BR | 14 |
| Université de Bordeauxlocation not on record | 13 |
| UFBAlocation not on record | 13 |
| Yaoundé, CM | 13 |
| UFPElocation not on record | 12 |
| UFMGlocation not on record | 10 |
| Departamento de Sistematica e Ecologialocation not on record | 10 |
| Taipei, TW | 10 |
| UERJlocation not on record | 9 |
| Nagano City, JP | 9 |
| Nanjing, CN | 9 |
| Laboratorio de Ictiologialocation not on record | 9 |
| Tampa, US | 8 |
| Puerto Ayora, EC | 8 |
| UTFPR-CPlocation not on record | 7 |
| Nishihara, JP | 7 |
| Chicago, US | 7 |
| UNICAMPlocation not on record | 6 |
| Campo Mourão, BR | 6 |
| Chengdu, CN | 6 |
| IPA/SPlocation not on record | 6 |
| INMAlocation not on record | 6 |
| Herbier National du Gabonlocation not on record | 6 |
| TAIElocation not on record | 6 |
| Kew, GB | 6 |
| Bogotá, D.C., CO | 6 |
| Hangzhou, CN | 5 |
| Taipei, TW | 5 |
| CEPLAClocation not on record | 5 |
| Guangzhou, CN | 5 |
| Fujian Institute of Subtropical Botanylocation not on record | 5 |
| UnBlocation not on record | 5 |
| Toyota city nature sanctuarylocation not on record | 4 |
| Durango, MX | 4 |
| Universidade de São Paulolocation not on record | 4 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 4 |
| Xiamen, CN | 4 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 4 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 4 |
| UFRRJlocation not on record | 4 |
| Bando, JP | 4 |
| Santa Cruz de la Sierra, BO | 4 |
| Shanghai, CN | 4 |
| ESALQlocation not on record | 4 |
| University of Santo Tomas Museumlocation not on record | 4 |
| Sagamihara, JP | 4 |
| Ischia Marine Centrelocation not on record | 4 |
| Station d'Ecologie de Lamtolocation not on record | 4 |
| National Biodiversity Institute, Costa Ricalocation not on record | 3 |
| BMlocation not on record | 3 |
| Seropédica, BR | 3 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 3 |
| Kawasaki Shi Tama Ku, JP | 3 |
| Feira de Santana, BR | 3 |
| UFSClocation not on record | 3 |
| CJBGlocation not on record | 3 |
| Institut de Recherche Agronomique de Guinée (IRAG)location not on record | 3 |
| Uppsala, SE | 3 |
| Aarhus, DK | 3 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 3 |
| Zhejiang Museum of Natural Historylocation not on record | 3 |
| KURAlocation not on record | 3 |
| Quito, EC | 3 |
| Jishou Universitylocation not on record | 2 |
| Universidade Federale do Rio Grande do Sullocation not on record | 2 |
| Edinburgh, GB | 2 |
| Seoul, KR | 2 |
| National Herbarium of São Tomé and Principelocation not on record | 2 |
| Ivano-Frankivsk, UA | 2 |
| Montréal, CA | 2 |
| Museu Paraense Emílio Goeldilocation not on record | 2 |
| Paleontological Collectionlocation not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| Porto Alegre, BR | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| San Isidro, AR | 2 |
| FJIDClocation not on record | 2 |
| UFABClocation not on record | 2 |
| Santiago de Cali, CO | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Harvard Universitylocation not on record | 2 |
| Pretoria, ZA | 2 |
| Shanghai, CN | 2 |
| Corrientes, AR | 2 |
| Glocation not on record | 2 |
| Castelar, AR | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| UNIVASFlocation not on record | 2 |
| Alicante, ES | 1 |
| UESBlocation not on record | 1 |
| Institut de Recherche Agronomique de Guinée (IRAG)location not on record | 1 |
| IAPlocation not on record | 1 |
| EAlocation not on record | 1 |
| Forestry Research Institute of Nigerialocation not on record | 1 |
| LISClocation not on record | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| Universidade de Passo Fundolocation not on record | 1 |
| MAlocation not on record | 1 |
| Minia, EG | 1 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 1 |
| Chongqing Museumlocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Frankfurt am Main | 1 |
| Mlocation not on record | 1 |
| Cusco, PE | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| CNF-UFHBlocation not on record | 1 |
| LDlocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| San José, CR | 1 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Clocation not on record | 1 |
| Cambridge, US | 1 |
| NSMKlocation not on record | 1 |
| Changsha, CN | 1 |
| Cruz das Almas, BR | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| UFESlocation not on record | 1 |
| Lake Charles, US | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Burlington, US | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 1 |
| ASUlocation not on record | 1 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 1 |
| DSMlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| Brasília, BR | 1 |
| UFOPlocation not on record | 1 |
| Berlin, DE | 1 |
| Yangling, CN | 1 |
| Chengdu, CN | 1 |
| UFSCarlocation not on record | 1 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 1 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| UNESP-IBILCElocation not on record | 1 |
| Fort Worth, US | 1 |
| Londrina, BR | 1 |
| Ilhéus, BR | 1 |
| UTFPR-SLlocation not on record | 1 |
| Zhuzhou, CN | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Philadelphia, US | 1 |
| Museo Athanasius Kircher di Romalocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| Leiden University Medical Centerlocation not on record | 1 |
| Helsinki, FI | 1 |
185 institutions · 1 744 of 1 834 vouchered records shown · 82 without an institution code
09Environmental DNA31 detections
Where the DNA of Liparis nervosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found31
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 31 detections have coordinates
Open the map2 countries0
Stones beside streams
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.4 °C 13.3–19.4
Seasonal swing summer↔winter8.40 °C
Max temp (day)20.1 °C 17.6–22.6
Min temp (night)12.5 °C 9.30–15.7
Precipitation244 mm/mo 156–333
Air humidity70.4 % 69.4–71.5
Moisture balance138 mm/mo 37.9–238
Vapour deficit558 Pa 472–645
Wind speed2.10 m/s 1.90–2.40
Cloud cover58.3 % 54.6–61.9
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.