Liopsetta glacialis

(Pallas, 1776) · species

image placeholder — illustration coming later

Animalia/Chordata/Pleuronectiformes/Pleuronectidae/Liopsetta

At a glance

Occurrence records1 426

Data sources10

Biological traits10

DNA specimens8

eDNA detections298

Sources10 archives

Databases and archives Liopsetta glacialis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility681 records↗

OBISOcean Biodiversity Information System745 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI298 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources10 traits

Occurrence & distributionGBIF · OBIS1 426 records

Environmental DNA4 datasets · 1 countries298 detections

DNA & barcodingBOLD8 specimens

01Narrative

The Arctic flounder (Liopsetta glacialis), also known as the Christmas flounder, eelback flounder and Polar plaice, is a flatfish of the family Pleuronectidae. It is a demersal fish that lives on coastal mud bottoms in salt, brackish and fresh waters at depths of up to 90 m. Its native habitat is the polar waters of the northeastern Atlantic and Arctic oceans, from the White and Barents seas to the coasts of Siberia in Russia and Queen Maud Gulf in Canada, and from the Chuckchi and Bering seas to Bristol Bay in Alaska and the northern Sea of Okhotsk. It can grow up to 35 cm in length.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length44 cm

Life cycle & reproduction1

Max. longevity312 months

Habitat & environment4

Habitat brackishyes

Habitat freshwateryes

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max90 m

Depth min0 m

Vulnerability63.55

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Liopsetta glacialis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections298

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

342Avariable

381Cvariable

429Avariable

639Cmostly conserved

CTCTATCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGGACAGGCCTAAGTCTACTCATTCGAGCAGAACTAAGCCAACCTGGGGCTCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes3

BIN1

Most divergent pair0.61%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Platichthys stellatussame family4.3%Platichthys flesussame family4.8%Kareius bicoloratussame family5.6%Pleuronectes quadrituberculatussame family6.0%Limanda ferrugineasame family6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_082783 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBrrn12rrn16

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 426 records

Wild obs. + sensor1 159

Museum / vouchered267

Origin

Native5

Range

Area of Occupancy AOO1 640 km²

Depth

0–200 m sunlit43

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 3 m · max 530 m · 45 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 2≤1 km 1>10 km 18

21 georeferenced · 1 138 without coordinates

Open the mapobservation + sensor1 159

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 10≤1 km 6≤10 km 7>10 km 7

30 georeferenced · 237 without coordinates

Open the institutions mapphysical evidence267

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	25
Washington, US	16
Stockholm, SE	13
Toronto, CA	9
Helsinki, FI	7
University of Victorialocation not on record	5
CASlocation not on record	5
UWFClocation not on record	4
Edmonton, CA	2
Cambridge, US	1
FishBaselocation not on record	1
	1
Texas Cooperative Wildlife Collectionlocation not on record	1
University of California San Diegolocation not on record	1
Chicago, US	1

15 institutions · 92 of 267 vouchered records shown · 13 without an institution code

09Environmental DNA298 detections

Where the DNA of Liopsetta glacialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found298

Studies independent surveys4

Countries1

Verifiable raw sequence linked296

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 298 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C -6.60–18.8

Seasonal swing summer↔winter25.9 °C

Max temp (day)17.2 °C -2.90–21.9

Min temp (night)12.7 °C -9.40–17.1

Precipitation99.6 mm/mo 89.3–129

Air humidity61.6 % 60.3–64.0

Moisture balance36.9 mm/mo -45.6–95.0

Vapour deficit597 Pa 136–828

Wind speed4.80 m/s 3.90–6.20

Cloud cover52.2 % 46.6–63.6

CHELSA 1981–2010, ~9 km grid, at location & month of 296 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Liopsetta glacialis

At a glance

Sources10 archives

Size & morphology1

Life cycle & reproduction1

Habitat & environment4

Uses & economy1

Other traits3

At a glance

Record type1 426 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 426 records