Liopropoma santi

Baldwin & Robertson, 2014 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Serranidae/Liopropoma

At a glance

Occurrence records23

Data sources9

Biological traits6

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Liopropoma santi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility18 records↗

OBISOcean Biodiversity Information System5 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS23 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Liopropoma santi, the spot-tail golden bass, is a species of marine ray-finned fish, related to the groupers and classified within the subfamily Epinephelinae of the family Serranidae. It has been collected from deep reefs off Curaçao, southern Caribbean; it is the deepest occurring Liopropoma species in the Atlantic Ocean.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length11.6 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic-neritic

Other traits3

Depth max241 m

Depth min182 m

Vulnerability10

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Liopropoma santi has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CCTATATCTAGTATTTGGTGCCTGGGCCGGAATAGTAGGCACAGCCCTAAGCCTCCTGATTCGAGCCGAACTAAGCCAGCCAGGAGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Liopropoma olneyisame genus12.0%Liopropoma mowbrayisame genus13.3%Bathyanthias mexicanussame family13.8%Liopropoma aberranssame genus14.4%Schedophilus huttonisame order15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type23 records

Museum / vouchered23

Origin

Native1

Range

Area of Occupancy AOO12 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 0 m · 1 record with depth

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 23 records without

Open the institutions mapphysical evidence23

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	14
UWFClocation not on record	1

2 institutions · 15 of 23 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Liopropoma santi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.2 °C 27.2–27.2

Seasonal swing summer↔winter2.10 °C

Max temp (day)27.8 °C 27.6–27.8

Min temp (night)26.6 °C 26.4–26.6

Precipitation43.7 mm/mo 43.7–47.0

Air humidity65.3 % 65.3–66.6

Moisture balance-149 mm/mo -151–-149

Vapour deficit1,254 Pa 1,197–1,254

Wind speed4.30 m/s 4.30–4.90

Cloud cover33.5 % 33.5–33.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)