Linum cariense — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Linaceae/Linum

At a glance

Occurrence records2

Data sources6

Biological traits2

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Linum cariense's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS6 compounds

Occurrence & distributionGBIF2 records

DNA & barcodingNCBIsequences

01Narrative

Linum cariense is a species of flowering plant in the family Linaceae which is endemic to Turkey.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formperennial

Habitat & environment1

Climatetemperate

03Chemical composition6 compounds

Compounds documented for Linum cariense across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Arylnaphthalene and aryltetralin lignans12

Documented compounds6 total

Compound	Amount	Source
(5R,5aR,8aR,9R)-4-methoxy-5-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-9-(3,4,5-trimethoxyphenyl)-5a,6,8a,9-tetrahydro-5H-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one	present	LOTUS
6-Methoxypodophyllotoxin	present	LOTUS
alpha-Peltatin	present	LOTUS
beta-Peltatin	present	LOTUS
Podophyllotoxin	present	LOTUS
Podophyllotoxin glucoside	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Linum cariense has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSMK066693.1 ↗583 bp

ACGT

AATGACTAGCGAACTCGTTGTTAATCCTCGACGGGGTCGGACACAGATGCGGCCCCTGGTCCTTTGTGTGACGCCCTCGTCTTGCGGGAT …

Linum cariense internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	1
South Kensington, GB	1

2 institutions · 2 of 2 vouchered records shown