Linum campanulatum

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Linaceae/Linum

At a glance

Occurrence records5 784

Data sources9

Biological traits6

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Linum campanulatum's data was compiled from.

GBIFGlobal Biodiversity Information Facility5 784 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources6 traits

Occurrence & distributionGBIF5 784 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 28

02Traits & measurements

SourcesWCVPTRY

Size & morphology2

Plant height0.2 m

Seed mass2.28 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment2

Climatesubtropical

Growth formsubshrub

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Linum campanulatum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK066691.1 ↗585 bp

ACGT

AATGACCAGCGAACTCGTTGTTAATATCCTCGACGGGGTCGGACACAGATGCGACCCCTGGTCCTTTGTGTGATGGCCTCGTCTTGCGGG …

Linum campanulatum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Linum campanulatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome records28–282n range28median28mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 284×CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015

CCDB · book-ipcn67-71 — BARI, G., & M.B.E. GODWARD. 1970. Interspecif ic crosses in Linum. Euphytica 19: 443-446.

CCDB · book-ipcn75-78 — Natarajan 1978

CCDB · book-ipcn75-78 — Na tarajan 1977

CCDB · CromoCat 2015 — Natarajan, G. (1978b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 526-531.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type5 784 records

Wild obs. + sensor5 583

Museum / vouchered186

Cultivated / captive1

Other14

Origin

Introduced1

Range

Area of Occupancy AOO5 848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy26% within 1 km

≤100 m 984≤1 km 320≤10 km 3 547>10 km 70

4 921 georeferenced · 662 without coordinates

Open the mapobservation + sensor5 583

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 4≤1 km 28≤10 km 43>10 km 1

76 georeferenced · 110 without coordinates

Open the institutions mapphysical evidence186

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BClocation not on record	34
BDBClocation not on record	24
BIO-UNIPIlocation not on record	22
South Kensington, GB	18
Barcelona, ES	17
València, ES	8
LDlocation not on record	7
MAlocation not on record	6
Paris, FR	5
Vitoria, ES	3
MeiseBGlocation not on record	2
Denver, US	2
Vancouver, CA	1
Entomological Society of Latvialocation not on record	1
Salamanca, ES	1
MHNAIXlocation not on record	1
Dresden, DE	1
BRNUlocation not on record	1
RJBJCIlocation not on record	1
Uniwersytet Śląski w Katowicachlocation not on record	1
College of the Atlantic, Museumlocation not on record	1
Granada, ES	1
Pamplona, ES	1
JBCLMlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Madrid, ES	1
Alicante, ES	1
Monastir, TN	1
Adam Mickiewicz University in Poznańlocation not on record	1
Bloomington, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Wlocation not on record	1
IPE-CSIClocation not on record	1
Sion, CH	1
Oskarshamn, SE	1

36 institutions · 172 of 186 vouchered records shown · 13 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Linum campanulatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 16.9–16.9

Seasonal swing summer↔winter20.4 °C

Max temp (day)21.7 °C

Min temp (night)9.90 °C

Precipitation49.2 mm/mo

Air humidity53.2 %

Moisture balance-91.3 mm/mo

Vapour deficit908 Pa

Wind speed2.20 m/s

Cloud cover35.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Linum campanulatum

At a glance

Sources9 archives

Size & morphology2

Life cycle & reproduction2

Habitat & environment2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 784 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 784 records