Linum arboreum

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Linaceae/Linum

At a glance

Occurrence records137

Data sources11

Biological traits10

DNA specimens6

eDNA detections6

Sources11 archives

Databases and archives Linum arboreum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility137 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF137 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Linum arboreum là một loài thực vật có hoa trong họ Linaceae. Loài này được L. mô tả khoa học đầu tiên năm 1753.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Plant height0.4 m

Seed mass2.45 mg

Life cycle & reproduction4

Life formsubshrub or shrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Lifespan years7 years

Habitat & environment4

Aquaticterrestrial

Climatesubtropical

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: d Z

Woodinesswoody

03Chemical composition4 compounds

Compounds documented for Linum arboreum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Arylnaphthalene and aryltetralin lignans4

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
6-Methoxypodophyllotoxin	present	LOTUS
alpha-Peltatin	present	LOTUS
beta-Peltatin	present	LOTUS
Podophyllotoxin	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Linum arboreum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences10

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMK066681.1 ↗583 bp

ACGT

AATGACCAGCGAACTCGTTGTTAATCCTCGACGGGGTCGGACACAGATGCGGCCCCTGGTCCTTTGTGTGATGGCCTCGTCTTGCGGGAT …

Linum arboreum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL3★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Linum arboreum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome records28–282n range28median28mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 286×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-fedorov +1

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

CCDB · ipcn-api-dl — Montmollin, B. d. 1986. étude cytotaxonomique de la flore de la Crète. III. Nombres chromosomiques. Candollea 41: 431–439.

CCDB · ipcn-api-dl — Iatrou, G. A. 1989. Linum hellenicum (Linaceae), a new species from Peloponnesos, Greece. Willdenowia 19: 69–73.

CCDB · book-fedorov — Ray C. 1944

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type137 records

Wild obs. + sensor59

Museum / vouchered78

Origin

Introduced6

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 19≤1 km 20≤10 km 3>10 km 2

44 georeferenced · 15 without coordinates

Open the mapobservation + sensor59

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 3≤1 km 3≤10 km 4

10 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence78

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	55
South Kensington, GB	6
GJOlocation not on record	4
Barcelona, ES	2
Wlocation not on record	2
València, ES	2
BRNUlocation not on record	1
Berlin, DE	1
MAlocation not on record	1
Denver, US	1

10 institutions · 75 of 78 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Linum arboreum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 17.0–17.0

Seasonal swing summer↔winter16.2 °C

Max temp (day)18.5 °C

Min temp (night)14.9 °C

Precipitation55.2 mm/mo

Air humidity62.8 %

Moisture balance-51.6 mm/mo

Vapour deficit758 Pa

Wind speed3.00 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)