Linum alpinum

Jacq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Linaceae/Linum

At a glance

Occurrence records11 184

Data sources7

Biological traits21

DNA specimens2

eDNA detections1

Sources7 archives

Databases and archives Linum alpinum's data was compiled from.

GBIFGlobal Biodiversity Information Facility11 184 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF11 184 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 18

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height0.488 m

Plant height generative0.531 m

Plant height max0.3 m

Plant height min0.1 m

Seed length4.5 mm

Seed mass1.99 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering endAug

Flowering startJun

Life formperennial

Life spanperennial

Lifespan years8 years

Raunkiær life formhemicryptophyte

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)231 mg/g

Photosynthetic pathwayC3

Other traits1

Diaspore typeseed

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Linum alpinum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK066680.1 ↗580 bp

ACGT

AATGACCAGCGAACTTGTTGTTAAATGCGGGGGAGGCTGATGTTTGGTGTGCCCTAGGTCCACCACGCGAAGGCCTGCCTCGCTCGGCGG …

Linum alpinum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Linum alpinum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–362n range18median18mode26records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1820×CCDB · ita-fl · CCDB · iber-fl · CCDB · fl-europaea +6

CCDB · ita-fl — CHICHIRICC G., TAMMARO F. - 1981 (1980). Numeri cromosomici per la flora italiana:742-751.. Inform. Bot. Ital. , 12(2): 161-165.

CCDB · iber-fl — Recherches sur les liens de parent entre la flore orophile des Alpes et celledes Pyrnes. Kpfer, P.Boissiera23: 3-322(1974).

CCDB · fl-europaea — Ockendon , 1971

CCDB · ipcn-api-dl — Chichiricco, G. & F. Tammaro. 1980. Numeri cromosomici per la Flora Italiana: 742-751. Inform. Bot. Ital. 12: 161–165.

CCDB · ipcn-api-dl — Dobea, C. & B. Hahn. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 15–18.

CCDB · book-ipcn72 — PETROVA, A.V. 1972. In IOPB chromosome number reports XXXV. Taxon 21: 161-166.

CCDB · book-ipcn72 — SEETHARAM, A. 1972. Interspecific hybridization in Linum. Euphytica 21: 489-495.

CCDB · book-ipcn72 — SZ.-BORSOS, 0. 1971. Contribution to the knowledge on the chromosome numbers of Phanerogams growing in Hungary and southeastern Europe. II. Acta Bot. Acad. Sci. Hung. 17: 37-46.

CCDB · book-ipcn67-71 — BARI, G., & M.B.E. GODWARD. 1970. Interspecif ic crosses in Linum. Euphytica 19: 443-446.

CCDB · book-ipcn67-71 — OCKENDON, D.J. 1968. Biosystematic studies in the Linum perenne group. New Phytol. 67: 787-813.

CCDB · book-fedorov — Vilmorin, Simonet 1927b flav

CCDB · book-fedorov — Ray C. 1944

CCDB · book-atlas-flowering-plants — Ray 1944

CCDB · CromoCat 2015 — Borsos, O. (1971). Contribution to the knowledge on the chromosome numbers of Phanerogams growing in Hungary and South-eastern Europe. II. Acta Bot. Acad. Sci. Hung. 17: 37-46.

CCDB · CromoCat 2015 — Dobeš, C. & Hahn, B. (1997). IOPB Chromosome Data 11 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 26-27: 15-18.

CCDB · CromoCat 2015 — Petrova, A. (1972). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXV]. Taxon 21(1): 164.

CCDB · CromoCat 2015 — Petrova, A. (1973). Taxonomicno proucvane na divorastjastite predstaviteli ot roda Linum L. (len) v Balgarija. II. Bull. Inst. Bot. 24: 5-29.

CCDB · CromoCat 2015 — Stace, C. A. (1997). IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. 26/27: 13-26

CCDB · CromoCat 2015 — Lovka, M., Susnik, F., Löve, A. & Löve, D. (1972). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXVI]. Taxon 21(2/3): 337-339.

2n 365×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Van Loon, J. C. & B. Kieft. 1980. In Chromosome number reports LXVIII. Taxon 29: 538–542.

CCDB · book-fedorov — Kikuchi 1929

CCDB · book-fedorov — Nagao S. 1941b

CCDB · book-fedorov — D. 1955)

CCDB · book-atlas-flowering-plants — Nagao 1941

2n 301×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Chaudhuri, B.K. & Sen, S. 1976

n 91×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — OCKENDON, D.J. 1968. Biosystematic studies in the Linum perenne group. New Phytol. 67: 787-813.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type11 184 records

Wild obs. + sensor10 780

Museum / vouchered396

Cultivated / captive1

Other7

Range

Area of Occupancy AOO8 356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1 869≤1 km 412≤10 km 6 541>10 km 233

9 055 georeferenced · 1 725 without coordinates

Open the mapobservation + sensor10 780

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 18≤1 km 51≤10 km 94>10 km 1

164 georeferenced · 232 without coordinates

Open the institutions mapphysical evidence396

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	120
GJOlocation not on record	51
Conservatoire botanique national du Bassin parisienlocation not on record	40
Salzburg, AT	19
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	14
Wlocation not on record	14
Institut und Museum fuer Geologie und Palaeontologielocation not on record	13
BClocation not on record	12
Bern, CH	11
GZUlocation not on record	10
Entomological Society of Latvialocation not on record	8
Oskarshamn, SE	7
Porrentruy, CH	6
Provincia di Livornolocation not on record	5
Zürich, CH	5
MAlocation not on record	5
BRNUlocation not on record	3
Sion, CH	3
València, ES	3
Adam Mickiewicz University in Poznańlocation not on record	3
CJBGlocation not on record	2
Berlin, DE	2
Görlitz, DE	2
SZUlocation not on record	2
Tartu, EE	2
Glarus, CH	2
Mlocation not on record	2
Salamanca, ES	1
Fribourg, CH	1
Denver, US	1
Moscow State Universitylocation not on record	1
Madrid, ES	1
Uniwersytet Śląski w Katowicachlocation not on record	1
Bourges, FR	1
Boumlocation not on record	1
Podgorica, ME	1

36 institutions · 375 of 396 vouchered records shown · 21 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Linum alpinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Linum alpinum

At a glance

Sources7 archives

Size & morphology6

Life cycle & reproduction7

Habitat & environment5

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type11 184 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type11 184 records