Linospadix monostachyos

(Mart.) H.Wendl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Linospadix

At a glance

Occurrence records1 667

Data sources8

Biological traits21

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Linospadix monostachyos's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 667 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources21 traits

Occurrence & distributionGBIF1 667 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Linospadix monostachyos known as the walking stick palm is a small palm growing in rainforest understorey in Queensland and New South Wales.Kew World Checklist of Selected Plant FamiliesGovaerts, R. & Dransfield, J. (2005). World Checklist of Palms: 1-223. The Board of Trustees of the Royal Botanic Gardens, Kew.Dowe, J.L. (2010). Australian palms: biogeography, ecology and systematics: 1-290. CSIRO Publishing. Walking stick palm in flower, Nightcap National Park, Australia

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRY

Size & morphology8

Fruit length12 mm

Fruit width10 mm

Leaf length215 mm

Leaf mass per area51.68 g/m2

Leaf width102 mm

Petiole length13.5 cm

Plant height3 m

⚠ sources differ — AusTraits: 3 m · TRY: 6 m

Seed mass183 mg

Life cycle & reproduction6

Deciduousnessevergreen

Dispersal typeanimal

Flowering timennnnnnnnnnnn

Life spanperennial

Resprouting capacityresprouts

Sex typemonoecious

Habitat & environment5

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesscompound

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Linospadix monostachyos has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes4

GenBank sequences10

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKJ634516.1 ↗366 bp

ACGT

TCGAGGGCATGCCTGCCTGGGCATCATGCCAAAAATGATGCTTCGCTCCCCCCGGGGCCACGATGGGCTTCGGGGTGGCCGGATGCGGAC …

Linospadix monostachyos voucher Fredriksen et al. C-210 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 667 records

Wild obs. + sensor1 357

Museum / vouchered233

Cultivated / captive5

Other72

Origin

Native37

Introduced8

Range

Area of Occupancy AOO3 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 1 256≤1 km 35≤10 km 22

1 313 georeferenced · 44 without coordinates

Open the mapobservation + sensor1 357

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 20≤1 km 36≤10 km 67>10 km 34

157 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence233

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 2

4 georeferenced · 1 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	47
Brisbane, AU	45
Museo Entomologico de Leonlocation not on record	32
Smithfield, AU	30
Canberra, AU	30
Armidale, AU	19
John T. Waterhouse Herbariumlocation not on record	9
Adelaide, AU	8
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Paris, FR	1
Kensington, AU	1
Hobart, AU	1
US	1

13 institutions · 226 of 233 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Linospadix monostachyos was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.3 °C 11.3–11.3

Seasonal swing summer↔winter15.8 °C

Max temp (day)15.1 °C

Min temp (night)7.30 °C

Precipitation76.5 mm/mo

Air humidity62.5 %

Moisture balance-8.00 mm/mo

Vapour deficit552 Pa

Wind speed4.60 m/s

Cloud cover41.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Linospadix monostachyos

At a glance

Sources8 archives

Size & morphology8

Life cycle & reproduction6

Habitat & environment5

Physiology & chemistry1

Other traits1

At a glance

Record type1 667 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 13 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 667 records