Linnaea borealis
speciesAt a glance
Occurrence records137 713
Data sources14
Biological traits43
DNA specimens109
eDNA detections153
Sources14 archives
Databases and archives Linnaea borealis's data was compiled from.
WikipediaWikimedia Foundation15 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility137 713 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI153 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics109 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources43 traits
Occurrence & distributionGBIF137 713 records
Environmental DNA2 datasets · 10 countries153 detections
DNA & barcodingBOLD · NCBI109 specimens
Genome at a glanceCCDB · GoaT · NCBI978 Mbp
01Narrative
Linnaea borealis is a species of flowering plant in the family Caprifoliaceae (the honeysuckle family). Until 2013, it was the only species in the genus Linnaea. It is a boreal to subarctic woodland subshrub, commonly known as twinflower (sometimes written twin flower). This plant was a favorite of Carl Linnaeus, founder of the modern system of binomial nomenclature, for whom the genus was named.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass3.1 mg
Leaf size62.14 mm²
⚠ sources differ — TRY: 62.14 mm² · LEDA: 76.61 mm² · GIFT: 76.61 mm²
Plant height0.155 m
⚠ sources differ — GIFT: 0.155 m · LEDA: 0.035 m · TRY: 0.03 m
Plant height generative0.09 m
Plant height max1.2 m
Plant height min0.1 m
Seed length2.75 mm
Seed mass2 mg
⚠ sources differ — TRY: 2 mg · LEDA: 0.87 mg · GIFT: 1.28 mg
Seed mass max2.38 mg
Seed mass min1 mg
Life cycle & reproduction14
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endAug
Flowering startJun
Life formsubshrub
Life spanperennial
Lifespan years16 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formchamaephyte
Reproduction asexualabsent
Seed number1
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Fruit typeachene
Growth formherb
⚠ sources differ — GIFT: herb · TRY: herb/shrub
Habitat GIFTforest, shrubberies, tundra
Mycorrhiza typearbuscular
Woodinessvariable
⚠ sources differ — TRY: non-woody/woody · LEDA: semi-woody · GIFT: woody
Physiology & chemistry8
Leaf C:N ratio44.6 g/g
Leaf c471 mg/g
Leaf dry-matter content (LDMC)300 mg/g
⚠ sources differ — TRY: 300 mg/g · LEDA: 252 mg/g
Leaf n12.15 mg/g
Leaf p1.83 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)21.85 mm²/mg
⚠ sources differ — TRY: 21.85 mm²/mg · LEDA: 29.16 mm²/mg · GIFT: 29.16 mm²/mg
Other traits1
Diaspore typefruit
05DNA & barcoding109 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Linnaea borealis has left across the world's sequence archives.
At a glance
DNA specimens109
Marker genes9
GenBank sequences10
eDNA detections153
Countries11
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCAAGTCTTTGAACACAAGTTGCACCCGAAGCCATTAGGCCGAGGGCACGTCTTCCTGGGCGTCACACATC …
Linnaea borealis voucher EDNA20-0060110 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK2★rbcL7★rbcLa★trnL-F★ITS1★ITS1★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Linnaea borealis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size978 000 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Linnaea borealis0.98 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidypolyploid inferred
Chromosome records32–322n range32median32mode39records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3239×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · iapt · CCDB · brit-fl +9
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · iapt
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Bot. J. Scotl. : ()
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3808
CCDB · fl-europaea — V. Sorsa, 1962
CCDB · poland — Skali?ska M. et al. 1964. Additions to chromosome numbers of Polish Angiosperms (Fifth contribution). Acta Soc. Bot. Pol. 33, 45-76.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Yurtsev, B. A. & P. G. ZHUKOVA. 1982. Chromosome numbers of some plants of the northeastern Yakutia (the drainage of the Indigirka River in its middle reaches). Bot. Zhurn. 67 (6): 778–787. (In Russian).
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl — Semerenko, L. V. 1990. Chromosome numbers of some flowering plants from the Berezinsky Biosphere Reservation (the Byelorussian Soviet Socialist Republic). Bot. Žhurn. (Moscow & Leningrad) 75: 279–282.
CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1991. Chromosome numbers in some plant species from the south-west of the Komi ASSR. Bot. Žhurn. (Moscow & Leningrad) 76: 769–771.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1991. Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR). Bot. Žhurn. (Moscow & Leningrad) 76: 473–476.
CCDB · ipcn-api-dl — Benko-Iseppon, A. M. 1992. Karyologische Untersuchung der Caprifoliaceae s.l. und möglicher verwandter Familien. Wien, Formal– und Naturwiss. Fak. Univ. Wien. (Dissertation.).
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. N. SIPLIVINSKY. 1975. Chromosome numbers and taxonomy of some species of Baikal flora. Bot. Žhurn. (Moscow & Leningrad) 60(6): 864–872.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1976. Chromosome numbers of some Western Chukolka plant species, II. Bot. Žhurn. (Moscow & Leningrad) 61(7): 963–969.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Chromosome numbers of plant species from the Tunkinsky Alpes (East Sayan). News Sib. Depart. Acad. Sci. USSR, Ser. Biol. 15(3): 46–52.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.
CCDB · book-ipcn67-71 — ZHUKOVA, P.G . & A.D. TIKHONOVA. 1971. Chromosome numbers of certain plant species indigenous to the Chukotsky province. (In Russian). Bot. Zurn. 56: 868-875.
CCDB · book-northern-plants — L. & L. 1944 h. Ehrenberg 1945, Vaarama (unpubl.).
CCDB · eflora
CCDB · book-fedorov — Hagerup 1944a
CCDB · book-fedorov — Love A., Love D. 1944b
CCDB · book-fedorov — Hagerup (LOve A., Love D. 1942b)
CCDB · book-fedorov — LOve A., LOve D. 1944b, 1966
CCDB · book-fedorov — Ehrenberg L. 1945
CCDB · book-fedorov — Vaarama (Love A., LOve D. 1948)
CCDB · book-fedorov — Love A. 1954b
CCDB · book-fedorov — Sorsa V. 1962
CCDB · book-fedorov — Packer 1964
CCDB · book-fedorov — Skalinska 1964
CCDB · book-fedorov — Skalinska et al. 1964
CCDB · book-fedorov — Love A., Ritchie 1966
CCDB · book-fedorov — Taylor R L., Brockman 1966
CCDB · book-atlas-flowering-plants — L. & L. 1944b
CCDB · book-atlas-flowering-plants — Ehrenberg 1945
n 162×CCDB · book-ipcn73-74 · CCDB · Cave1963
CCDB · book-ipcn73-74 — POJAR, J. 1973. Levels of polyploidy in four vegetation types of southwestern British Columbia. Canad. J. Bot. 51: 621-628. I
CCDB · Cave1963 — Sorsa 1962
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness99.6% BUSCO
08Occurrence & distribution
Record type137 713 records
Wild obs. + sensor130 716
Museum / vouchered6 960
Cultivated / captive14
Other23
Origin
Native996
Introduced14
Range
Area of Occupancy AOO259 748 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy72% within 1 km
≤100 m 54 687≤1 km 32 875≤10 km 31 564>10 km 2 203
121 329 georeferenced · 9 387 without coordinates
Open the mapobservation + sensor130 716
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy41% within 1 km
≤100 m 430≤1 km 1 137≤10 km 1 807>10 km 475
3 849 georeferenced · 3 111 without coordinates
Open the institutions mapphysical evidence6 960
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy90% within 1 km
≤100 m 1≤1 km 8>10 km 1
10 georeferenced · 4 without coordinates
Open the mapnot free-living14
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions139 of 274 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 736 |
| LDlocation not on record | 489 |
| Olocation not on record | 443 |
| Uniwersytet Wrocławskilocation not on record | 250 |
| Oskarshamn, SE | 169 |
| Trondheim, NO | 167 |
| TROMlocation not on record | 166 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 146 |
| Jyväskylä, FI | 139 |
| Oulu, FI | 139 |
| South Kensington, GB | 136 |
| Bergen, NO | 123 |
| Tartu, EE | 118 |
| Turku, FI | 118 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 115 |
| KFGBlocation not on record | 104 |
| WTUlocation not on record | 103 |
| Québec, CA | 101 |
| KMNlocation not on record | 91 |
| Kuopio, FI | 91 |
| Moscow, US | 84 |
| Université Lavallocation not on record | 84 |
| Chongqing Museumlocation not on record | 77 |
| Uppsala, SE | 75 |
| Saint John, CA | 73 |
| Vancouver, CA | 69 |
| Toronto, CA | 69 |
| SLU Artdatabankenlocation not on record | 69 |
| Philadelphia, US | 67 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 60 |
| Tallinn, EE | 60 |
| Missoula, US | 56 |
| Zürich, CH | 55 |
| Zürich, CH | 51 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 47 |
| Ann Arbor, US | 46 |
| Shinshu Universitylocation not on record | 46 |
| Pullman, US | 43 |
| Montréal, CA | 40 |
| University of Alberta Museumslocation not on record | 38 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 34 |
| Green Bay, US | 33 |
| Victoria, CA | 32 |
| Porvoo, FI | 32 |
| Salzburg, AT | 29 |
| 东北师范大学自然博物馆location not on record | 27 |
| Adam Mickiewicz University in Poznańlocation not on record | 26 |
| Provo, US | 26 |
| Helsinki, FI | 24 |
| GJOlocation not on record | 23 |
| Bronx, US | 23 |
| Boise, US | 23 |
| BSBIlocation not on record | 23 |
| Tsukuba, JP | 22 |
| Odawara, JP | 21 |
| Toyama, JP | 21 |
| University of Stellenboschlocation not on record | 21 |
| Beijing, CN | 21 |
| TUR-Alocation not on record | 20 |
| Kandalaksha State Nature Reservelocation not on record | 20 |
| Rovaniemi, FI | 19 |
| Bern, CH | 16 |
| Stockholm, SE | 16 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 16 |
| Flagstaff, US | 16 |
| Paris, FR | 16 |
| Görlitz, DE | 15 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 15 |
| University of Birminghamlocation not on record | 14 |
| Spearfish, US | 14 |
| FFPRIlocation not on record | 13 |
| Tempe, US | 13 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 13 |
| Portland, US | 13 |
| Memorial University of Newfoundlandlocation not on record | 12 |
| BMlocation not on record | 12 |
| Acadia Universitylocation not on record | 11 |
| Tacoma, US | 11 |
| IWEP FEB RASlocation not on record | 11 |
| Kostrzyca Forest Gene Banklocation not on record | 11 |
| Pocatello, US | 11 |
| Anchorage, US | 10 |
| ENTClocation not on record | 10 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 10 |
| Bozeman, US | 10 |
| Fargo, US | 9 |
| Sanda, JP | 9 |
| Bangkok, TH | 9 |
| University of Lethbridgelocation not on record | 9 |
| Madison, US | 9 |
| Sion, CH | 9 |
| Sendai, JP | 9 |
| Chiba, JP | 9 |
| Cheney, US | 9 |
| PTHlocation not on record | 9 |
| Albuquerque, US | 8 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 8 |
| USFS/BHSClocation not on record | 8 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 8 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 8 |
| Urumqi, CN | 8 |
| Rocky Mountain Biological Laboratorylocation not on record | 7 |
| Wlocation not on record | 7 |
| Millersville, US | 7 |
| Pacific Lutheran Universitylocation not on record | 7 |
| Durham, US | 7 |
| Cambridge University Herbariumlocation not on record | 7 |
| Nagano City, JP | 6 |
| Pittsburg, US | 6 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 6 |
| Saint Louis, US | 6 |
| Institute of the biological problems of the North FEB RASlocation not on record | 6 |
| Logan, US | 5 |
| MeiseBGlocation not on record | 5 |
| Karlsruhe, DE | 5 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 5 |
| MAlocation not on record | 5 |
| Denver, US | 5 |
| Provincia di Livornolocation not on record | 5 |
| St. Paul, US | 5 |
| Angwin, US | 5 |
| BFLlocation not on record | 5 |
| JP | 5 |
| Staten Island, US | 5 |
| WINlocation not on record | 5 |
| nbflocation not on record | 5 |
| KIRMlocation not on record | 4 |
| NMWlocation not on record | 4 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| Dekalb, US | 4 |
| Glarus, CH | 4 |
| BRNUlocation not on record | 4 |
| University of British Columbia, Herbariumlocation not on record | 4 |
| Guangzhou, CN | 4 |
| WNNUlocation not on record | 4 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| Kew, GB | 4 |
| Columbia, US | 4 |
| DBF-NHMDlocation not on record | 3 |
| Ypsilanti, US | 3 |
| Bourges, FR | 3 |
| PRClocation not on record | 3 |
| Emporia, US | 3 |
| Beijing Normal Universitylocation not on record | 3 |
| Bloomington, US | 3 |
| Yukon Universitylocation not on record | 3 |
| J.F.Oberlin Universitylocation not on record | 3 |
| University of Gdansk, Dept. of Plant Taxonomy & Nature Conservationlocation not on record | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| SZUlocation not on record | 3 |
| Servico de Microbiologia e Imunologialocation not on record | 3 |
| San Angelo, US | 3 |
| The Manitoba Museum, Botany Departmentlocation not on record | 3 |
| Bando, JP | 3 |
| Warwickshire Museumlocation not on record | 3 |
| Arcata, US | 3 |
| Mississippi State, US | 3 |
| University of Victorialocation not on record | 3 |
| Science Museum of Minnesotalocation not on record | 3 |
| Natural History Museum Rotterdamlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Whitewater, US | 3 |
| Bend, US | 3 |
| Porrentruy, CH | 3 |
| Elocation not on record | 3 |
| Hudson, US | 2 |
| Davis, US | 2 |
| Forssa, FI | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| Davenport, US | 2 |
| Hamilton, US | 2 |
| B.A. Bennett Herbariumlocation not on record | 2 |
| Barcelona, ES | 2 |
| National Museums Northern Ireland (Ulster Museum)location not on record | 2 |
| Cambridge, US | 2 |
| University of Oxfordlocation not on record | 2 |
| Knoxville, US | 2 |
| Blumenau, BR | 2 |
| Omachi Alpine Museumlocation not on record | 2 |
| Durango, US | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Brock University (BU)location not on record | 2 |
| Inner Mongolia Universitylocation not on record | 2 |
| Taipei, TW | 2 |
| US | 2 |
| Dresden, DE | 2 |
| Wellington, NZ | 2 |
| Göteborg, SE | 2 |
| KNFYlocation not on record | 1 |
| Montréal, CA | 1 |
| UTFPR-CPlocation not on record | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| PVTlocation not on record | 1 |
| University of Aberdeen Museumslocation not on record | 1 |
| BIRM|GLlocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| Riverside, US | 1 |
| BIRM|HLUlocation not on record | 1 |
| Xiamen, CN | 1 |
| Trois-Rivières, CA | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Sevilla, ES | 1 |
| AUAlocation not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| HBNClocation not on record | 1 |
| Northridge, US | 1 |
| Beijing, CN | 1 |
| Edinburgh, GB | 1 |
| Claremont, US | 1 |
| ifplocation not on record | 1 |
| Glocation not on record | 1 |
| Yangling, CN | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Phoenix, US | 1 |
| Walla Walla, US | 1 |
| Miami, US | 1 |
| Honolulu, US | 1 |
| MBNClocation not on record | 1 |
| San Luis Obispo, US | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Haslemere Educational Museumlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Grand Junction, US | 1 |
| West of Scotland College of Agriculturelocation not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Churchill Northern Studies Centrelocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Nanjing, CN | 1 |
| Forestry and Forest Products Research Institutelocation not on record | 1 |
| Research Collection of Jonathan Farrlocation not on record | 1 |
| Chicago, US | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| US | 1 |
| Corrientes, AR | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| IDElocation not on record | 1 |
| Dhaka, BD | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Otaru, JP | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Tuscaloosa, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Kushiro City Museumlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Hokkaido University Museumlocation not on record | 1 |
| Williamsburg, US | 1 |
| València, ES | 1 |
| BAYLUlocation not on record | 1 |
| Tampere, FI | 1 |
| Campo Mourão, BR | 1 |
| Portland, US | 1 |
| Caldwell, US | 1 |
| Chicago, US | 1 |
| GZUlocation not on record | 1 |
| Chengdu, CN | 1 |
| Tomioka, JP | 1 |
| New Haven, US | 1 |
| HAWlocation not on record | 1 |
| Corvallis, US | 1 |
| Chadron, US | 1 |
| CJBGlocation not on record | 1 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| Berlin, DE | 1 |
| McWane Science Centerlocation not on record | 1 |
| Austin, US | 1 |
| Glasgow University Herbariumlocation not on record | 1 |
274 institutions · 6 527 of 6 960 vouchered records shown · 432 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA153 detections
Where the DNA of Linnaea borealis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found153
Studies independent surveys2
Countries10
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 153 detections have coordinates
Open the map10 countries0
zonal forestEstablished riverbar with Picea glauca and P…Under the forest40° fine scree south-facing slope on conglom…Hillside roadside of Blacktail Drive with Fr…Closed Picea glauca forest, mesic to dry on …
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.5 °C 12.6–19.1
Seasonal swing summer↔winter20.6 °C
Max temp (day)17.5 °C 16.2–23.5
Min temp (night)10.1 °C 8.80–14.7
Precipitation74.2 mm/mo 50.9–90.7
Air humidity62.4 % 58.9–62.7
Moisture balance-17.1 mm/mo -55.8–3.80
Vapour deficit579 Pa 551–916
Wind speed4.00 m/s 2.40–4.50
Cloud cover35.9 % 27.5–44.4
CHELSA 1981–2010, ~9 km grid, at location & month of 136 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.