Lindheimera texana

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Lindheimera

At a glance

Occurrence records7 320

Data sources12

Biological traits8

DNA specimens6

eDNA detections3

Sources12 archives

Databases and archives Lindheimera texana's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 320 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Chemical compositionLOTUS · NPASS29 compounds

Occurrence & distributionGBIF7 320 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Lindheimera texana, commonly known as Texas yellow star, is a species of flowering plant in the tribe Heliantheae within the family Asteraceae. It is found in the south-western United States (Oklahoma and Texas) and northern Mexico (Coahuila). Other common names include star daisy, Texas star and Lindheimer daisy,("NPIN: Lindheimera texana (Texas yellowstar)." Lady Bird Johnson Wildflower Center - The University of Texas at Austin. N.p., n.d. Web. 10 Mar. 2010. <http://www.wildflower.org/plants/result.php?id_plant=LITE3>.)

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition29 compounds

Compounds documented for Lindheimera texana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cycloartane triterpenoids7

Dihydroflavonols4

Flavanones3

Labdane diterpenoids3

Cycloeudesmane sesquiterpenoids $ Eudesmane sesquiterpenoids3

Documented compounds29 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Sclareolide	present	LOTUS
(1S,3R,8R,11S,12S,14S,15R,16R)-14-hydroxy-7,7,12,16-tetramethyl-15-[(2R)-1-[(2S,3S)-3-propan-2-yloxiran-2-yl]propan-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-one	present	LOTUS
(1S,3R,8R,11S,12S,14S,15R,16R)-14-hydroxy-7,7,12,16-tetramethyl-15-[(2R,4S,5S)-4,5,6-trihydroxy-6-methylheptan-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-one	present	LOTUS
(1S,4R,5R,6R,8R,10S,12S,13S,16R,18S,21R)-4,6,12,17,17-pentamethyl-8-(2-methylprop-1-enyl)-9-oxahexacyclo[11.9.0.01,21.04,12.05,10.016,21]docosan-18-ol	present	LOTUS
(1S,4R,5R,6R,8R,10S,12S,13S,16R,21R)-3',3',4,6,12,17,17-heptamethylspiro[9-oxahexacyclo[11.9.0.01,21.04,12.05,10.016,21]docosane-8,5'-dioxolane]-18-one	present	LOTUS
(1S,4R,5R,6R,8S,10S,12S,13S,16R,18S,21R)-4,6,12,17,17-pentamethyl-8-(2-methylprop-1-enyl)-9-oxahexacyclo[11.9.0.01,21.04,12.05,10.016,21]docosan-18-ol	present	LOTUS
(1S,4R,5R,6R,8S,10S,12S,13S,16R,21R)-4,6,12,17,17-pentamethyl-8-(2-methylprop-1-enyl)-9-oxahexacyclo[11.9.0.01,21.04,12.05,10.016,21]docosan-18-one	present	LOTUS
(1S,4R,5R,6S,9S,11S,12S,15R,20R)-4,6,11,16,16-pentamethyl-8-oxahexacyclo[10.9.0.01,20.04,11.05,9.015,20]henicosane-7,17-dione	present	LOTUS
(2R,3R)-3,5,7-trihydroxy-2-(4-hydroxy-3-methoxyphenyl)-8-(3-methylbut-2-enyl)-2,3-dihydrochromen-4-one	present	NPASS
(2R,3R)-3,5,7-trihydroxy-6-(3-methylbut-2-enyl)-2-phenyl-2,3-dihydrochromen-4-one	present	NPASS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lindheimera texana has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences9

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSU74435.2 ↗219 bp

ACGT

TCATGTCGTCCTCTCTAAAGGCCTTTGATAAGTGTTTTTGGTTGGGGCGGAGACTGGTCTCCTGTGCCTATGGTGTGGTTGGCCTAAAAG …

Lindheimera texana internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS7★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Lindheimera texana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 163×CCDB · eflora · CCDB · book-fedorov

CCDB · eflora

CCDB · book-fedorov — Turner, Johnston 1956

CCDB · book-fedorov — I. 1958)

n 82×CCDB · book-ipcn73-74 · CCDB · Cave1958

CCDB · book-ipcn73-74 — URBATSCH, L.E. 1974. In IOPB chromosome number reports XLV. Taxon 23: 619-624.

CCDB · Cave1958 — Turner & Johnston 1956

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type7 320 records

Wild obs. + sensor6 753

Museum / vouchered567

Origin

Introduced20

Range

Area of Occupancy AOO10 756 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 4 002≤1 km 685≤10 km 228>10 km 359

5 274 georeferenced · 1 479 without coordinates

Open the mapobservation + sensor6 753

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 11≤1 km 83≤10 km 165>10 km 62

321 georeferenced · 246 without coordinates

Open the institutions mapphysical evidence567

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Fort Worth, US	201
Austin, US	82
Bronx, US	66
BAYLUlocation not on record	40
Texas Lutheran Universitylocation not on record	32
Wuzhou, CN	24
Lubbock, US	17
Denton, US	11
Stephenville, US	10
Emporia, US	9
Bangkok, TH	7
Riverside, US	7
Chongqing Museumlocation not on record	6
EL PASO, US	5
University of Stellenboschlocation not on record	5
Davis, US	5
Saint Louis, US	5
Burlington, US	2
Denver, US	2
Chadron, US	2
San Luis Obispo, US	2
Mississippi State, US	2
Stockholm, SE	2
LDlocation not on record	2
Bloomington, US	2
Flagstaff, US	2
Dekalb, US	1
Jena Microbial Resource Collectionlocation not on record	1
MeiseBGlocation not on record	1
Tempe, US	1
Pittsburg, US	1
Moscow State Universitylocation not on record	1
Davenport, US	1
GB	1
Waverly, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Edmonton, CA	1
Oskarshamn, SE	1

38 institutions · 562 of 567 vouchered records shown · 5 without an institution code

09Environmental DNA3 detections

Where the DNA of Lindheimera texana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 15.9–15.9

Seasonal swing summer↔winter18.6 °C

Max temp (day)22.2 °C

Min temp (night)11.2 °C

Precipitation68.0 mm/mo

Air humidity57.6 %

Moisture balance-44.2 mm/mo

Vapour deficit764 Pa

Wind speed4.10 m/s

Cloud cover35.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Lindheimera texana

At a glance

Sources12 archives

Life cycle & reproduction2

Diet & foraging1

Habitat & environment5

Compound class profile5 classes

Documented compounds29 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type7 320 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions29 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 320 records