Limnephilus flavicornis

(Fabricius, 1787) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Trichoptera/Limnephilidae/Limnephilus

At a glance

Occurrence records25 204

Data sources7

Biological traits2

DNA specimens81

eDNA detections107

Sources7 archives

Databases and archives Limnephilus flavicornis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 204 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI107 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics81 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF25 204 records

Environmental DNA3 datasets · 13 countries107 detections

DNA & barcodingBOLD81 specimens

Genome at a glanceGoaT2n = 60

01Narrative

Limnephilus flavicornis is een schietmot uit de familie Limnephilidae. L. flavicornis is een van de meest voorkomende soorten uit de familie en is veelal te vinden in de buurt van stilstaand water, van mei tot oktober. De soort werd voor het eerst wetenschappelijk beschreven door Johann Christian Fabricius.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)possible nectivore

Feeding guild (larval)omnivore

05DNA & barcoding81 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Limnephilus flavicornis has left across the world's sequence archives.

At a glance

DNA specimens81

BINs3

Marker genes3

eDNA detections107

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus67 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 63 variable positions, in barcode order

7Tmostly conserved

22Amostly conserved

23Amostly conserved

40Tmostly conserved

50Cmostly conserved

58Gvariable

76Amostly conserved

94Gmostly conserved

97Tmostly conserved

118Tmostly conserved

121Tmostly conserved

127Amostly conserved

136Tmostly conserved

187Cmostly conserved

190Amostly conserved

202Cmostly conserved

205Tmostly conserved

206Tmostly conserved

214Cmostly conserved

223Cmostly conserved

263Cmostly conserved

266Tmostly conserved

268Amostly conserved

274Cmostly conserved

277Cmostly conserved

280Tmostly conserved

286Tmostly conserved

316Amostly conserved

319Cmostly conserved

322Tmostly conserved

346Cmostly conserved

358Cmostly conserved

364Cmostly conserved

367Tmostly conserved

379Tmostly conserved

385Cmostly conserved

400Tmostly conserved

403Tmostly conserved

424Tmostly conserved

427Tmostly conserved

428Tmostly conserved

458Cmostly conserved

500Tmostly conserved

507Tmostly conserved

514Tmostly conserved

529Cmostly conserved

530Cmostly conserved

532Amostly conserved

550Tmostly conserved

553Tmostly conserved

562Amostly conserved

577Gvariable

578Tmostly conserved

583Cmostly conserved

589Cmostly conserved

604Amostly conserved

610Tmostly conserved

634Cmostly conserved

640Cmostly conserved

641Cmostly conserved

646Tmostly conserved

649Amostly conserved

652Cmostly conserved

AACTATTTATTTTATTTTTGGAATCTGAGCAGGAATAGTTGGAACTTCACTAAGAATGATTATTCGAACCGAATTAGGTACTACAGAATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes14

BINs3

Most divergent pair10.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Limnephilus marmoratussame genus2.3%Limnephilus stigmasame genus4.1%Limnephilus indivisussame genus4.9%Limnephilus alienussame genus7.9%Limnephilus guadarramicussame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18SWnt1

animal barcoderibosomalmarker

06Genome at a glanceGoaT

The complete instruction manual Limnephilus flavicornis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 601×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type25 204 records

Wild obs. + sensor22 823

Museum / vouchered2 327

Fossil27

Other27

Origin

Native417

Range

Area of Occupancy AOO23 564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 6 047≤1 km 1 899≤10 km 12 177>10 km 8

20 131 georeferenced · 2 692 without coordinates

Open the mapobservation + sensor22 823

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 767≤1 km 352≤10 km 918>10 km 49

2 086 georeferenced · 241 without coordinates

Open the institutions mapphysical evidence2 327

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	383
DanishLepidopterologicalSocietylocation not on record	325
SLU Artdatabankenlocation not on record	297
Zürich, CH	200
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	196
Natural History Museum Rotterdamlocation not on record	130
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	93
Helsinki, FI	70
NTNU-VMlocation not on record	42
AQBGlocation not on record	35
Tartu, EE	28
LEBAlocation not on record	26
Stockholm, SE	22
Porrentruy, CH	21
BioFokuslocation not on record	20
NHMOlocation not on record	17
South Kensington, GB	10
Frankfurt am Main	9
Kuopio, FI	9
Tilburg, NL	7
Philadelphia, US	6
Natural History Museum, Londonlocation not on record	6
Geneva, CH	6
Tromsø, NO	6
Bern, CH	5
Uniwersytet Łódzkilocation not on record	4
Institute of Biology of the University of Latvialocation not on record	4
GdAMlocation not on record	4
ZMAAlocation not on record	4
Champaign, US	2
MZLUlocation not on record	2
neflocation not on record	1
Paro, BT	1
Musee cantonal de zoologie de Lausannelocation not on record	1
University of Vienna, Dept of Botany and Biodiversity Researchlocation not on record	1
Rovaniemi, FI	1
Institute of Zoology Slovak Academy of Scienceslocation not on record	1

37 institutions · 1 995 of 2 327 vouchered records shown · 332 without an institution code

09Environmental DNA107 detections

Where the DNA of Limnephilus flavicornis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found107

Studies independent surveys3

Countries13

Verifiable raw sequence linked51

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 107 detections have coordinates

Open the map13 countries0

Floodplain foreststream

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 8.60–17.2

Seasonal swing summer↔winter18.8 °C

Max temp (day)18.2 °C 12.3–21.4

Min temp (night)10.7 °C 5.40–13.8

Precipitation69.9 mm/mo 54.5–118

Air humidity61.3 % 58.0–64.2

Moisture balance-18.5 mm/mo -58.4–34.0

Vapour deficit631 Pa 463–801

Wind speed3.10 m/s 2.30–4.20

Cloud cover47.4 % 37.4–55.3

CHELSA 1981–2010, ~9 km grid, at location & month of 101 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Limnephilus flavicornis

At a glance

Sources7 archives

Diet & foraging2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type25 204 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type25 204 records