Lilium nobilissimum — The Life Data

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Lilium

At a glance

Occurrence records0

Data sources6

Biological traits3

DNA specimens4

eDNA detections4

Sources6 archives

Databases and archives Lilium nobilissimum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Lilium nobilissimum (jap.: Tamoto-yuri) ist eine Art aus der Gattung der Lilien (Lilium) in der orientalischen Sektion.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction1

Life formbulbous geophyte

Habitat & environment2

Climatetemperate

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lilium nobilissimum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLC652854.1 ↗632 bpJapan

ACGT

TCGAGAACCCGACCGAGAGACCGCGAACCTGTAAACGGACGACACCGTGTCGGGCGGGCATTATGTCCGCCCTACTCGGGACCTCGCATC …

Lilium nobilissimum 11 genes for ITS1, 5.8S rRNA, ITS2, partial and complete seqeunce

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2ITS3

plant barcodefungal barcode

09Environmental DNA4 detections

Where the DNA of Lilium nobilissimum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.