Lilium nepalense

D.Don · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Lilium

At a glance

Occurrence records77

Data sources9

Biological traits17

DNA specimens7

eDNA detections7

Sources9 archives

Databases and archives Lilium nepalense's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility77 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF77 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Lilium nepalense is een soort lelie die van nature voorkomt in de centrale en oostelijke Himalaya.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Leaf length75 mm

Leaf length max100 mm

Leaf length min50 mm

Leaf width max30 mm

Leaf width min20 mm

Life cycle & reproduction2

Life formbulbous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatetemperate

Climberself-supporting

Elevation max2 900 m

Elevation mean2 775 m

Elevation min2 100 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lilium nepalense has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR763311.1 ↗628 bp

ACGT

TCGAGAACCGATCGAGAGACCGCGAACCTGTAAACGGATGACACCGTGTTGGGCGGGTGTTATGCCTGTCCTACTCGGGACCTCGCATCA …

Lilium nepalense voucher gyd1392 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL7★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Lilium nepalense carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 248×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74 +1

CCDB · ipcn-api-dl — Smyth, D. R., K. Kongsuwan & S. Wisudharomn. 1989. A survey of C-band patterns of Lilium (Liliaceae). Pl. Syst. Evol. 163: 53–69.

CCDB · ipcn-api-dl — Yamaguchi, S., M. Kobayashi, B. Roy & I. Okuda. 1990. Preliminary report on the karyotype of Lilium nepalense. Jap. J. Breed. 40: 245–248.

CCDB · ipcn-api-dl — Xie, X. y., Z. j. Gu & Q. a. Wu. 1992. Cytological studies of the genus Nomocharis and its related genera. Acta Phytotax. Sin. 30(6): 487–497.

CCDB · ipcn-api-dl — Bhattarai, S. & S. B. Malla. 1994. Karyotype of Lilium nepalense D. Don. News Lett. Himalayan Bot. 16: 15–16.

CCDB · book-ipcn75-78 — Sen 1978

CCDB · book-ipcn73-74 — SEN, S. 1973. Structural hybridity intra-and interspecific level in Liliales. Folia Biol. (Cracow) 21: 83-197.

CCDB · book-ipcn73-74 — MALLA, S.B., S. BHATTARAI, N. SHRESTHA, & M.P. SINGH. 1974. In IOPB chromosome number reports XLVI. Taxon 23: 801-812.

CCDB · eflora

2n 231×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1990. Cytotax. Liliaceae Allied Fam. Continental Publishers, Kerala, India.

n 121×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Sen 1978

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type77 records

Wild obs. + sensor28

Museum / vouchered49

Range

Area of Occupancy AOO176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 6≤1 km 8≤10 km 4>10 km 3

21 georeferenced · 7 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence49

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	24
Kunming, CN	12
Chengdu, CN	3
GMBAlocation not on record	2
Edinburgh, GB	2
Kathmandu, NP	1
Bronx, US	1
Guilin, CN	1
National Herbarium and Plant Laboratories, Nepallocation not on record	1

9 institutions · 47 of 49 vouchered records shown · 2 without an institution code

09Environmental DNA7 detections

Where the DNA of Lilium nepalense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter12.2 °C

Max temp (day)27.4 °C

Min temp (night)21.0 °C

Precipitation195 mm/mo

Air humidity67.4 %

Moisture balance72.5 mm/mo

Vapour deficit1,032 Pa

Wind speed1.80 m/s

Cloud cover25.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)