Lichina pygmaea

(Lightf.) C.Agardh · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lichinomycetes/Lichinales/Lichinaceae/Lichina

At a glance

Occurrence records6 017

Data sources11

Biological traits0

DNA specimens7

eDNA detections547

Sources11 archives

Databases and archives Lichina pygmaea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 452 records↗

OBISOcean Biodiversity Information System2 565 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI547 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS13 compounds

Occurrence & distributionGBIF · OBIS6 017 records

Environmental DNA2 datasets · 1 countries547 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceGoaT · NCBI≈32 Mbp

01Narrative

فوقس قزمي هو نوع من الطلائعيات يتبع جنس الفوقس من الفصيلة الفوقسية.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition13 compounds

Compounds documented for Lichina pygmaea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aminoacids8

Mycosporine and Mycosporine-like amino acids2

Neutral glycosphingolipids1

Imidazole alkaloids1

Purine alkaloids1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-N-[(2S,3S,4R)-1-[(2S,3R,4S,5S,6R)-4-[(2S,3R,4R,5S)-5-[(1R)-1,2-dihydroxyethyl]-3,4-dihydroxyoxolan-2-yl]oxy-3,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,4-dihydroxyhexadecan-2-yl]-2-hydroxytetracosanamide	present	NPASS
(2S)-2-amino-5-[2-(2,4-dimethoxyphenyl)hydrazinyl]-5-oxopentanoic acid	present	LOTUS
(2S)-2-amino-5-[2-(3-hydroxyphenyl)hydrazinyl]-5-oxopentanoic acid	present	LOTUS
(4S)-6,7-dibromo-4-hydroxy-3,4-dihydro-2H-pyrrolo[1,2-a]pyrazin-1-one	present	NPASS
2-Amino-5-[2-(3-hydroxyphenyl)hydrazinyl]-5-oxopentanoic acid	present	LOTUS
3,7-Dimethylisoguanine	present	NPASS
benzyl (2S)-5-oxo-2-(phenylmethoxycarbonylamino)-5-[2-(3-phenylmethoxyphenyl)hydrazinyl]pentanoate	present	LOTUS
benzyl (2S)-5-oxo-2-(phenylmethoxycarbonylamino)-5-[2-(4-phenylmethoxyphenyl)hydrazinyl]pentanoate	present	LOTUS
Benzyl 5-oxo-2-(phenylmethoxycarbonylamino)-5-[2-(2-phenylmethoxyphenyl)hydrazinyl]pentanoate	present	LOTUS
L-Glutamic acid, N-[(phenylmethoxy)carbonyl]-, 1-(phenylmethyl) ester, 5-[2-[2-(phenylmethoxy)phenyl]hydrazide]	present	LOTUS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lichina pygmaea has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes2

GenBank sequences10

eDNA detections547

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMG554673.1 ↗420 bp

ACGT

TCTCTCCCAACCCCGGAGGTGCCCGGCGCCCAGCGATGGGCTGTCGGCGCCCCCAAGTGATGCCCTGTGTTGCAGGTCCGAGACCCCTCT …

Lichina pygmaea isolate 4251 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Lichina pygmaea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈32 421 062 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Lichina pygmaea0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness95.5% BUSCO

08Occurrence & distribution

Record type6 017 records

Wild obs. + sensor2 634

Museum / vouchered2 857

Other526

Range

Area of Occupancy AOO6 560 km²

Depth

0–200 m sunlit556

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 10 m · max 12.5 m · 556 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 837≤1 km 288≤10 km 615>10 km 2

1 742 georeferenced · 892 without coordinates

Open the mapobservation + sensor2 634

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 224≤1 km 38≤10 km 53>10 km 12

327 georeferenced · 2 530 without coordinates

Open the institutions mapphysical evidence2 857

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 49 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	119
DASSHlocation not on record	45
PNHSlocation not on record	37
Olocation not on record	25
Bergen, NO	22
University of Hamburglocation not on record	17
DOI/NPS, Colonial National Historical Parklocation not on record	16
Auckland, NZ	14
Madison, US	13
Museo Entomologico de Leonlocation not on record	9
ASUlocation not on record	9
Durham, US	8
Institut Francais pour l'Etude de la Merlocation not on record	7
LDlocation not on record	6
Chapel Hill, US	5
Uppsala, SE	4
486location not on record	4
Paris, FR	3
Canberra, AU	3
Kew, GB	3
Trondheim, NO	2
Berlin, DE	2
Philadelphia, US	2
Santa Barbara, US	2
Universidad de Málagalocation not on record	2
University of Stellenboschlocation not on record	2
Vitoria, ES	2
València, ES	2
Trondheim, NO	2
PHlocation not on record	2
M-Lichenslocation not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
GRAlocation not on record	1
St. Paul, US	1
Royal Botanic Gardens, Kewlocation not on record	1
Knoxville, US	1
Lincoln, US	1
South Kensington, GB	1
Madrid, ES	1
TROMlocation not on record	1
San Sebastián, ES	1
PRClocation not on record	1
US	1
Museo Achille Folettolocation not on record	1
Citadel Hill, GB	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Edinburgh, GB	1
Bronx, US	1
Helsinki, FI	1

49 institutions · 408 of 2 857 vouchered records shown · 581 without an institution code

09Environmental DNA547 detections

Where the DNA of Lichina pygmaea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found547

Studies independent surveys2

Countries1

Verifiable raw sequence linked540

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 547 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 7.70–16.2

Seasonal swing summer↔winter9.40 °C

Max temp (day)13.6 °C 9.10–17.9

Min temp (night)9.90 °C 6.10–14.5

Precipitation94.2 mm/mo 77.6–143

Air humidity64.3 % 63.4–65.2

Vapour deficit507 Pa 368–655

Cloud cover59.5 % 55.9–68.9

CHELSA 1981–2010, ~9 km grid, at location & month of 541 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Lichina pygmaea

At a glance

Sources11 archives

Compound class profile5 classes

Documented compounds13 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type6 017 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions27 of 49 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 017 records