Libinhania nimmoana — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Libinhania

At a glance

Occurrence records16

Data sources7

Biological traits1

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Libinhania nimmoana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF16 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Helichrysum nimmoanum is a species of flowering plant in the family Asteraceae. It is found only on the island of Socotra in Yemen. Its natural habitat is subtropical or tropical dry forests.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Libinhania nimmoana has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX896050.1 ↗642 bpYemen

ACGT

TCGAACCCTGCAAAGCAGAACGACCTGTGAACGTGTAACTACAACCGGGCAACACAGGAATCGAGCTTTTGTTTGACCCTTTGTTGTCTT …

Libinhania nimmoana isolate HnimmoYP2447 internal transcribed spacer 1, 5.8 ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

08Occurrence & distribution

Record type16 records

Museum / vouchered16

Range

Area of Occupancy AOO28 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence16

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	12
BClocation not on record	3
Stockholm, SE	1

3 institutions · 16 of 16 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Libinhania nimmoana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.