Libertia pulchella

(R.Br.) Spreng. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Libertia

At a glance

Occurrence records1 402

Data sources7

Biological traits40

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Libertia pulchella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 402 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources40 traits

Occurrence & distributionGBIF1 402 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 38

01Narrative

Libertia pulchella, the pretty grass-flag, is a plant in the iris family (Iridaceae). It is native to Papua New Guinea, New Zealand and Australia, where it occurs in New South Wales and Victoria and Tasmania. The flowering scape rises above the linear leaves producing 3 to 6 cream-coloured flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length4 mm

Fruit width4 mm

Leaf length115 mm

Leaf length max180 mm

Leaf length min50 mm

Leaf size4 926 mm²

Leaf width4.5 mm

Leaf width max7 mm

Leaf width min2 mm

Plant height0.3 m

⚠ sources differ — AusTraits: 0.3 m · TRY: 0.05 m

Seed length1 mm

Seed mass1.04 mg

⚠ sources differ — TRY: 1.04 mg · AusTraits: 1.1 mg · GIFT: 1.1 mg

Seed mass max1.1 mg

Seed mass min1.1 mg

Seed width1 mm

Life cycle & reproduction11

Dehiscencedehiscent

Dispersal typeself

Flowering endJan

Flowering startNov

Flowering timeynnnnnnnnnyy

Life formrhizomatous geophyte

Life spanperennial

Pollination syndromeinsect

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapefalcate linear

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Libertia pulchella has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPV221544.1 ↗154 096 bp

ACGT

CCCCCATATCTTACTAAAACAAGATATGGGGGCATGGAACCTTCAACGATTCGTATACATTAATACGGAAGTCTTATCCATTTATAGATG …

Libertia pulchella chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Libertia pulchella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome records36–382n range38median38mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 383×CCDB · new-zealand · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · new-zealand

CCDB · ipcn-api-dl — Blanchon, D. J., B. G. Murray & J. E. Braggins. 2000. Iridaceae: Chromosome numbers in the genus Libertia. New Zealand J. Bot. 38: 245–250.

CCDB · book-ipcn67-71 — HAIR, J. B., E. J. BEUZENBERG, & B. PEARSON. 1967. Contributions to a chromosome atlas of the New Zealand flora - 9. Miscellaneous families. N. Z. Jour. Bot. 5: 185-196.

2n 361×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Briggs, B. G., E. Edgar, K. L. Wilson & R. Snow. 2002. Chromosome numbers of some native and naturalised plant species in Australia. Telopea 9: 833–835.

n 191×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — HAIR, J. B., E. J. BEUZENBERG, & B. PEARSON. 1967. Contributions to a chromosome atlas of the New Zealand flora - 9. Miscellaneous families. N. Z. Jour. Bot. 5: 185-196.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 402 records

Wild obs. + sensor956

Museum / vouchered419

Cultivated / captive4

Other23

Origin

Native42

Introduced1

Range

Area of Occupancy AOO2 676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 641≤1 km 104≤10 km 106>10 km 14

865 georeferenced · 91 without coordinates

Open the mapobservation + sensor956

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 13≤1 km 131≤10 km 138>10 km 26

308 georeferenced · 111 without coordinates

Open the institutions mapphysical evidence419

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 2 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	104
Museo Entomologico de Leonlocation not on record	77
Canberra, AU	43
Mount Annan, AU	42
Palmerston North, NZ	39
Brisbane, AU	24
Christchurch, NZ	19
Kew, GB	14
Adelaide, AU	11
Honolulu, US	7
Parkville, AU	5
Armidale, AU	5
QVMAGlocation not on record	5
John T. Waterhouse Herbariumlocation not on record	4
Auckland, NZ	3
Smithfield, AU	3
Wellington, NZ	2
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Moscow State Universitylocation not on record	1
Kensington, AU	1
Chicago, US	1
Moscow, US	1
Palmerston, AU	1
Madison, US	1
University of Alberta Museumslocation not on record	1
MAlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1

28 institutions · 418 of 419 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Libertia pulchella

At a glance

Sources7 archives

Size & morphology15

Life cycle & reproduction11

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 402 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions19 of 28 geolocated

Cultivated / Captivenot free-living

Record type1 402 records