Libertia paniculata

(R.Br.) Spreng. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Libertia

At a glance

Occurrence records1 162

Data sources10

Biological traits36

DNA specimens3

eDNA detections1

Sources10 archives

Databases and archives Libertia paniculata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 162 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Occurrence & distributionGBIF1 162 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 76

01Narrative

Flower Libertia paniculata is a plant in the family Iridaceae. It is endemic to Australia, where it occurs in Queensland, New South Wales and Victoria.Kew World Checklist of Selected Plant FamiliesCooke, D.A. (1986). Flora of Australia 46: i-xii, 1-247. Australian Government Publishing Service, Canberra.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology11

Fruit length6.5 mm

Fruit width6.5 mm

Leaf length420 mm

Leaf length max600 mm

Leaf length min200 mm

Leaf width8 mm

Leaf width max12 mm

Leaf width min4 mm

Plant height0.6 m

Seed length1 mm

Seed width1 mm

Life cycle & reproduction11

Dehiscencedehiscent

Dispersal typeself

Flowering endNov

Flowering startSep

Flowering timennnnnnnnnyyn

Life formrhizomatous geophyte

Life spanperennial

Pollination syndromeinsect

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Libertia paniculata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKU564817.1 ↗573 bpAustralia

ACGT

AAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAAACCAAAGATACTGATATCTTGGCAGC …

Libertia paniculata ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLatrnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Libertia paniculata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 76 n = 38

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 761×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Blanchon, D. J., B. G. Murray & J. E. Braggins. 2000. Iridaceae: Chromosome numbers in the genus Libertia. New Zealand J. Bot. 38: 245–250.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 162 records

Wild obs. + sensor856

Museum / vouchered301

Cultivated / captive2

Other3

Origin

Native83

Introduced2

Range

Area of Occupancy AOO2 832 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 658≤1 km 83≤10 km 35>10 km 10

786 georeferenced · 70 without coordinates

Open the mapobservation + sensor856

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 51≤1 km 82≤10 km 99>10 km 26

258 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence301

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	84
Museo Entomologico de Leonlocation not on record	62
Canberra, AU	50
Brisbane, AU	28
Adelaide, AU	14
Armidale, AU	10
John T. Waterhouse Herbariumlocation not on record	9
Batemans Bay, AU	8
Wollongong, AU	6
Kew, GB	5
Hobart, AU	4
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Parkville, AU	3
Stockholm, SE	2
University of Stellenboschlocation not on record	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Wellington, NZ	1
CJBGlocation not on record	1

18 institutions · 294 of 301 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Libertia paniculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 15.6–15.6

Seasonal swing summer↔winter11.8 °C

Max temp (day)21.1 °C

Min temp (night)10.7 °C

Precipitation76.0 mm/mo

Air humidity59.2 %

Moisture balance-31.4 mm/mo

Vapour deficit736 Pa

Wind speed2.50 m/s

Cloud cover22.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Libertia paniculata

At a glance

Sources10 archives

Size & morphology11

Life cycle & reproduction11

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 162 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 162 records