Libertia ixioides

(G.Forst.) Spreng. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Libertia

At a glance

Occurrence records1 220

Data sources10

Biological traits26

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Libertia ixioides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 220 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Occurrence & distributionGBIF1 220 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 228

01Narrative

Libertia ixioides là một loài thực vật có hoa trong họ Diên vĩ. Loài này được (G.Forst.) Spreng. miêu tả khoa học đầu tiên năm 1824.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology14

Fruit length15 mm

Leaf length max500 mm

Leaf width10 mm

Leaf width max10 mm

Leaf width min10 mm

Seed length2 mm

Seed length max2 mm

Seed length min2 mm

Seed mass7 804 mg

Seed mass max15 608 mg

Seed mass min1 mg

Seed width1.5 mm

Seed width max1.5 mm

Seed width min1.5 mm

Life cycle & reproduction3

Life formtuberous geophyte

Raunkiær life formcryptophyte

Reproduction asexualpresent

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTCoastal

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Libertia ixioides has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLAJ309687.1 ↗1 335 bp

ACGT

TAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAAACCAAAGATACTGATATCTT …

Libertia ixioides chloroplast partial rbcL gene for ribulose-bisphosphate carboxylase large subunit

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Libertia ixioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 228 n = 114

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1712×CCDB · new-zealand · CCDB · ipcn-api-dl

CCDB · new-zealand

CCDB · ipcn-api-dl — Blanchon, D. J., B. G. Murray & J. E. Braggins. 2000. Iridaceae: Chromosome numbers in the genus Libertia. New Zealand J. Bot. 38: 245–250.

2n 2281×CCDB · new-zealand

CCDB · new-zealand

n 1141×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — HAIR, J. B., E. J. BEUZENBERG, & B. PEARSON. 1967. Contributions to a chromosome atlas of the New Zealand flora - 9. Miscellaneous families. N. Z. Jour. Bot. 5: 185-196.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 220 records

Wild obs. + sensor939

Museum / vouchered276

Cultivated / captive5

Range

Area of Occupancy AOO3 032 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 586≤1 km 136≤10 km 29>10 km 19

770 georeferenced · 169 without coordinates

Open the mapobservation + sensor939

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 9≤1 km 5≤10 km 5

19 georeferenced · 257 without coordinates

Open the institutions mapphysical evidence276

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 2 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	82
Auckland, NZ	78
Wellington, NZ	77
Palmerston North, NZ	21
Rotorua, NZ	11
Chicago, US	2
Hobart, AU	2
Vancouver, CA	1
Armidale, AU	1
Honolulu, US	1

10 institutions · 276 of 276 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Libertia ixioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Libertia ixioides

At a glance

Sources10 archives

Size & morphology14

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 220 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 10 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 220 records