Libertia grandiflora

(R.Br.) Sweet · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Libertia

At a glance

Occurrence records380

Data sources8

Biological traits36

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Libertia grandiflora's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility380 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources36 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF380 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 114

01Narrative

Libertia grandiflora est une plante à fleur herbacée du genre Libertia de la famille des Iridaceae. L'espèce est endémique de Nouvelle-Zélande.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology17

Fruit length15 mm

Fruit width10 mm

Leaf length max50 mm

Leaf width9 mm

Leaf width max9 mm

Leaf width min9 mm

Plant height0.5 m

Plant height max0.8 m

Seed length1.75 mm

Seed length max1.75 mm

Seed length min1.75 mm

Seed mass1.52 mg

Seed mass max1.66 mg

Seed mass min1.37 mg

Seed width1.5 mm

Seed width max1.5 mm

Seed width min1.5 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeunspecialized

Life formtuberous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Reproduction asexualpresent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTCoastal

Mycorrhizaabsent

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Libertia grandiflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Aminoacids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(S)-3-(2-Amino-2-carboxyethyl)benzoic acid		present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Libertia grandiflora has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLPV221546.1 ↗153 778 bp

ACGT

CCCCCATATCTTACTAAAATATGATATGGGGGCATGGAACCTTCAACGATTCGTATACATTAATACGGAAGTCTTATCCATTTATAGATG …

Libertia grandiflora chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Libertia grandiflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 114 n = 57

Ploidypolyploid inferred

Chromosome records114–1142n range114median114mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1142×CCDB · new-zealand · CCDB · book-fedorov

CCDB · new-zealand

CCDB · book-fedorov — Moore L. B. 1967

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type380 records

Wild obs. + sensor185

Museum / vouchered193

Cultivated / captive2

Range

Area of Occupancy AOO1 056 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 121≤1 km 25≤10 km 8>10 km 4

158 georeferenced · 27 without coordinates

Open the mapobservation + sensor185

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 5≤1 km 8≤10 km 3

16 georeferenced · 177 without coordinates

Open the institutions mapphysical evidence193

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	80
Christchurch, NZ	49
Wellington, NZ	37
Rotorua, NZ	12
Palmerston North, NZ	11
Hobart, AU	1
Canberra, AU	1
Chongqing Museumlocation not on record	1

8 institutions · 192 of 193 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)