Leucoraja wallacei

(Hulley, 1970) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Rajiformes/Rajidae/Leucoraja

At a glance

Occurrence records2 589

Data sources9

Biological traits8

DNA specimens23

eDNA detections23

Sources9 archives

Databases and archives Leucoraja wallacei's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility87 records↗

OBISOcean Biodiversity Information System2 502 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS2 589 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD23 specimens

01Narrative

De blancmangerog is een vissensoort uit de familie van de Rajidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1970 door Hulley.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length100 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonebathydemersal

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max517 m

Depth min70 m

Vulnerability60

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Leucoraja wallacei has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes2

eDNA detections23

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P600 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

33Gmostly conserved

34Cmostly conserved

180Amostly conserved

306Cmostly conserved

438Gvariable

TTGAGTCTTCTGATTCGGGCGGAACTAAGTCAGCCCGGGTCACTCCTAGGTGATGATCAGATTTATAATGTTCTTGTTACAGCCCATGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.29%

Haplotypes8

BIN1

Most divergent pair0.67%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Leucoraja naevussame genus2.3%Leucoraja melitensissame genus4.8%Leucoraja circularissame genus4.8%Leucoraja fullonicasame genus5.7%Amblyraja doellojuradoisame family8.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PND2

animal barcodemitochondrial

08Occurrence & distribution

Record type2 589 records

Wild obs. + sensor2 458

Museum / vouchered131

Range

Area of Occupancy AOO7 568 km²

Depth

0–200 m sunlit798

200–1000 m twilight330

1–4 km midnight0

>4 km abyssal0

median 165.2 m · max 510 m · 1 128 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1>10 km 3

4 georeferenced · 2 454 without coordinates

Open the mapobservation + sensor2 458

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 131 records without

Open the institutions mapphysical evidence131

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
South African Institute for Aquatic Biodiversitylocation not on record	50
FishBaselocation not on record	2

2 institutions · 52 of 131 vouchered records shown · 19 without an institution code

09Environmental DNA23 detections

Where the DNA of Leucoraja wallacei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 16.2–19.2

Seasonal swing summer↔winter5.40 °C

Max temp (day)19.7 °C 17.1–25.7

Min temp (night)15.5 °C 12.1–18.9

Precipitation33.6 mm/mo 3.20–42.8

Air humidity58.5 % 51.4–66.8

Vapour deficit764 Pa 699–1,028

Cloud cover13.4 % 13.0–16.7

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Leucoraja wallacei

At a glance

Sources9 archives

Size & morphology1

Habitat & environment3

Uses & economy1

Other traits3

At a glance

Record type2 589 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 589 records