Leucoraja erinacea

(Mitchill, 1825) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Rajiformes/Rajidae/Leucoraja

At a glance

Occurrence records57 257

Data sources8

Biological traits5

DNA specimens169

eDNA detections1 613

Sources8 archives

Databases and archives Leucoraja erinacea's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility57 257 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 613 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics169 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF57 257 records

Environmental DNA13 datasets · 2 countries1 613 detections

DNA & barcodingBOLD169 specimens

01Narrative

The little skate (Leucoraja erinacea) is a species of skate in the family Rajidae, found from Nova Scotia to North Carolina on sand or gravel habitats. They are one of the dominant members of the demersal fish community in the northwestern Atlantic. This species is of minimal commercial importance and is mostly used as bait for lobster traps, though its wings are also marketed for food. It is also important as a model organism for biological and medical research.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAnAge

Life cycle & reproduction4

Age at maturity (male)1 551 days

Age at sexual maturity1 460 days

Litter size30

Max. longevity96 months

Other traits1

Interbirth interval365 days

05DNA & barcoding169 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Leucoraja erinacea has left across the world's sequence archives.

At a glance

DNA specimens169

BINs3

Marker genes12

eDNA detections1 613

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus149 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

159Cmostly conserved

177Amostly conserved

195Tmostly conserved

210Tmostly conserved

312Gmostly conserved

351Cmostly conserved

399Cmostly conserved

411Gmostly conserved

471Cmostly conserved

645Amostly conserved

CTCTACCTAATCTTTGGTGCCTGAGCAGGTATAGTCGGAACTGGCTTAAGTCTTTTAATTCGAGCAGAATTGAGCCAGCCCGGATCACTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.73%

Haplotypes35

BINs3

Most divergent pair4.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Leucoraja ocellatasame genus4.3%Rajella bigelowisame family6.3%Rajella dissimilissame family6.7%Rajella fyllaesame family6.8%Rajella bathyphilasame family6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

08Occurrence & distribution

Record type57 257 records

Wild obs. + sensor56 776

Museum / vouchered480

Other1

Origin

Native8

Range

Area of Occupancy AOO61 744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 31≤1 km 698≤10 km 15>10 km 552

1 296 georeferenced · 55 480 without coordinates

Open the mapobservation + sensor56 776

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 9≤1 km 6≤10 km 24>10 km 17

56 georeferenced · 424 without coordinates

Open the institutions mapphysical evidence480

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	61
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	39
The Atlantic reference Centrelocation not on record	37
FishBaselocation not on record	26
Cambridge, US	24
New Haven, US	17
Toronto, CA	16
North Carolina Museum of Natural Scienceslocation not on record	12
Texas Cooperative Wildlife Collectionlocation not on record	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	6
Nova Scotia Museumlocation not on record	6
Chicago, US	5
Wuzhou, CN	4
Natural History Museum Rotterdamlocation not on record	4
Dalhousie Universitylocation not on record	2
Vancouver, CA	1
Maurice Lamontagne Institutelocation not on record	1
	1
University of Alabamalocation not on record	1

19 institutions · 270 of 480 vouchered records shown · 209 without an institution code

09Environmental DNA1 613 detections

Where the DNA of Leucoraja erinacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 613

Studies independent surveys13

Countries2

Verifiable raw sequence linked1 348

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 613 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C -0.4–17.6

Seasonal swing summer↔winter20.3 °C

Max temp (day)15.6 °C 2.80–20.2

Min temp (night)12.6 °C -3.60–16.4

Precipitation103 mm/mo 89.3–134

Air humidity65.0 % 60.8–73.4

Vapour deficit544 Pa 245–668

Cloud cover46.8 % 39.1–57.7

CHELSA 1981–2010, ~9 km grid, at location & month of 1 553 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Leucoraja erinacea

At a glance

Sources8 archives

Life cycle & reproduction4

Other traits1

At a glance

Record type57 257 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type57 257 records