Leucanthemum vulgare
Lam. · speciesAt a glance
Occurrence records677 325
Data sources11
Biological traits145
DNA specimens81
eDNA detections43
Sources11 archives
Databases and archives Leucanthemum vulgare's data was compiled from.
WikipediaWikimedia Foundation2 languages↗
GBIFGlobal Biodiversity Information Facility677 325 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics81 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources145 traits
Chemical compositionNPASS18 compounds
Occurrence & distributionGBIF677 325 records
Environmental DNA1 datasets · 8 countries43 detections
DNA & barcodingBOLD · NCBI81 specimens
Genome at a glanceCCDB · GoaT10.5 Gbp
01Narrative
Leucanthemum vulgare, commonly known as the ox-eye daisy, oxeye daisy, dog daisy, marguerite (, "common marguerite") and other common names, is a widespread flowering plant native to Europe and the temperate regions of Asia, and an introduced plant to North America, Australia and New Zealand.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology24
Fruit length2.25 mm
⚠ sources differ — AusTraits: 2.25 mm · GIFT: 2.75 mm
Fruit length max3 mm
Fruit length min2 mm
Leaf length70 mm
⚠ sources differ — AusTraits: 70 mm · GIFT: 55 mm
Leaf length max120 mm
Leaf length min30 mm
Leaf mass25.4 mg
Leaf size245 mm²
⚠ sources differ — TRY: 245 mm² · LEDA: 812 mm² · GIFT: 670 mm²
Leaf width20 mm
Leaf width max30 mm
Leaf width min15 mm
Plant height0.51 m
⚠ sources differ — GIFT: 0.51 m · AusTraits: 0.9 m · LEDA: 0.364 m · USDA: 0.396 m · TRY: 0.11 m
Plant height generative0.457 m
Plant height max1 m
Plant height min0.15 m
Seed length2.17 mm
⚠ sources differ — TRY: 2.17 mm · GIFT: 2.5 mm
Seed length max2.5 mm
Seed length min2.5 mm
Seed mass0.445 mg
⚠ sources differ — TRY: 0.445 mg · LEDA: 0.413 mg · GIFT: 0.812 mg
Seed mass max1.43 mg
Seed mass min0.2 mg
Seed volume0.455 mm³
Seed volume max0.53 mm³
Seed volume min0.38 mm³
Life cycle & reproduction38
Bloom periodSummer
Coppice potentialNo
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flower colourwhite
Flower conspicuousNo
Flowering endAug
Flowering startMay
Flowering timeyynnnnnnyyyy
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan categoryShort
Lifespan years4 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Resprouting capacityresprouts
Seed number289
Seed spread rateModerate
Seedling vigorMedium
Self fertilizationpresent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment32
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 400 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Growth form USDABunch
Habitat GIFTcrop fields, meadows, mountains, roadsides, shrubberies
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Leaf shapenarrowly_oblong oblanceolate
Low growing grassNo
Mycorrhiza typeAMNM
Root depth min8 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry28
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementLow
Fire resistantNo
Fire toleranceLow
Frost free days min130 days
Leaf C:N ratio23.63 g/g
Leaf c428 mg/g
Leaf dry-matter content (LDMC)199 mg/g
⚠ sources differ — TRY: 199 mg/g · LEDA: 124 mg/g
Leaf n22.77 mg/g
Leaf p1.62 mg/g
Moisture useLow
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max50 in
Precipitation min30 in
Protein potentialLow
Salinity toleranceNone
Seed longevity index0
Shade toleranceMedium
Soil pH max7 pH
Soil pH min5.2 pH
Specific leaf area (SLA)19.14 mm²/mg
⚠ sources differ — TRY: 19.14 mm²/mg · LEDA: 17.99 mm²/mg · GIFT: 19.27 mm²/mg
Temperature min-28 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound200 000 per lb
ToxicitySlight
Veneer productNo
Other traits6
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousYes
Fruit seed persistenceYes
Seeds per fruit101-1000
03Chemical composition18 compounds
Compounds documented for Leucanthemum vulgare across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Cholestane steroids3
Aporphine alkaloids $ Isoquinoline alkaloids2
Cholestane steroids $ Ergostane steroids2
Aporphine alkaloids1
Cholestane steroids $ Stigmastane steroids1
Documented compounds18 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (3S,8R,9R,10R,13R,14R,17R)-10,13-dimethyl-17-[(E,2R,5S)-5-methylhept-3-en-2-yl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | NPASS | |
| (3S,8R,9R,10R,13R,14R,17R)-10,13-dimethyl-17-[(E,2S)-5-methylhex-3-en-2-yl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | NPASS | |
| (3S,8R,9R,10R,13R,14R,17R)-17-[(E,2S,5R)-5,6-dimethylhept-3-en-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | NPASS | |
| [(3S,8R,9R,10R,13R,14R,17R)-10,13-dimethyl-17-[(2R)-6-methyl-5-methylideneheptan-2-yl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate | present | NPASS | |
| [(3S,8R,9R,10R,13R,14R,17R)-10,13-dimethyl-17-[(Z,2R,5R)-5-methylhept-3-en-2-yl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate | present | NPASS | |
| [(3S,8R,9R,10R,13R,14R,17R)-17-[(E,2S,5R)-5,6-dimethylhept-3-en-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate | present | NPASS | |
| AVSXSVCZWQODGV-OSLSSMLUSA-N | present | NPASS | |
| CJUZRVVXJPNXNH-FNDMPQOYSA-N | present | NPASS | |
| DSSYKIVIOFKYAU-BYDSUWOYSA-N | present | NPASS | |
| HJWVRQICRBWPME-DULMFAGHSA-N | present | NPASS |
05DNA & barcoding81 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Leucanthemum vulgare has left across the world's sequence archives.
At a glance
DNA specimens81
Marker genes10
GenBank sequences10
eDNA detections43
Countries8
The DNA barcodea real sequence read deposited for this species
TCGAACCCTGCAAAGCAGAACGACCCGTGAACACGTAATACAACCGAGCGTCGAGCGGGTTAAGCGCTAGTTTGATCCTCTCGATGCTTT …
Leucanthemum vulgare isolate LEUvul_L046 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL5★rbcLa★trnL-F★ITS2★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Leucanthemum vulgare carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size10 542 840 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Leucanthemum vulgare10.54 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–1082n range18median18mode165records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1886×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +14
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — FAVARGER C., VILLARD M. - 1965. Nouvelles recherches cytotaxonomiques sur Chrysanthemum leucanthemum L. sensu lat.. Bull. Soc. Bot. Suisse , 75: 57-79.
CCDB · ita-fl — LARSEN K., LAEGAARD S. - 1971. Chromosome studies of the sicilian flora.. Bot. Tidsskr. , 66(3): 249-268.
CCDB · ita-fl — MARCHI P., ILLUMINATI O., MACIOCE A., CAPINERI R., D'AMATO G. - 1983. Genome evolution and polyploidy in Leucanthemum vulgare Lam. aggr. (Compositae). Karyotype analysis and DNA microdensitometry.. Caryologia , 36(1): 1/1/2018.
CCDB · ita-fl — MARCHI P. - 1968. Sulla utilit di due indici ricavati dalla elaborazione biometrica dei cariotipi.. Giorn. Bot. Ital. , 102(6): 569.
CCDB · ita-fl — MARCHI P. - 1972 (1967-69). Per una revisione citotassonomica della flora italiana. Genere Leucanthemum Adans. em. Briq. et Cav. (Compositae): "Osservazioni su specie appartenenti al ciclo del L. vulgare Lamk.".. Ann. Bot. (Rome) , 29: 259-300.
CCDB · slov-fl — Zelený V., 1982: Kopretina bílá (Leucanthemum vulgare Lam.) v Československu. - Stud. Českoslov. Akad. Ved 10: 1-135 + Tab. 1-27.
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · brit-fl — Pearson, P.L. (1967)
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · brit-fl — Whitebrook, J. (1986)
CCDB · brit-fl — Bocher, T.W., Larsen, K. Watsonia 4: 11-16 (1957)
CCDB · iber-fl — Die gattung Leucanthemum Mill. (Compositae-Anthemideae) auf der iberischen halbinsel. Vogt, R.Ruizia10(1991).
CCDB · fl-europaea — Frey, 1969b
CCDB · poland — Bocher T. W. and Larsen K. 1957. Cytotaxonomical studies in the Chrysanthemum leucanthemum complex. Watsonia 4, 11-16.
CCDB · poland — Przywara L. and Schmager J. 1968. Cytotaxonomical studies on Chrysanthemum leucanthemum L. sensu lato. Acta Biol. Cracov. Ser. Bot. 11, 105-186.
CCDB · poland — Przywara L. 1974. Karyological studies on Leucanthemum vulgare s.l. from Poland. Acta Biol. Cracov. Ser. Bot. 17, 55-73.
CCDB · poland — Skali?ska M., Piotrowicz M., Soko?owska-Kulczycka A. et al. 1961. Further additions to chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 30, 463-489.
CCDB · book-ipcn65 — Larsen 1965b
CCDB · ipcn-api-dl — Przywara, L. 1974. Karyological studies on Leucanthemum vulgare s.1. from Poland. Acta Biol. Cracov., Ser. Bot. 17: 55–74.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 2000. Karyology of the flora of Byelarus. Page 42 in Thesis of the Diss. Doc. Biol. Sci. Minsk.
CCDB · ipcn-api-dl — Strid, A. & I. A. Andersson. 1985. Chromosome numbers of Greek mountain plants. An annotated list of 115 species. Bot. Jahrb. Syst. 107: 203–228.
CCDB · ipcn-api-dl — Probatova, N. S., A. P. Sokolovskaya & E. G. Rudyka. 1989. Chromosome numbers in some species of vascular plants from Kunashir Island (the Kuril Islands). Bot. Žhurn. (Moscow & Leningrad) 74: 1675–1678.
CCDB · ipcn-api-dl — Vogt, R. 1991. Die Gattung Leucanthemum Mill. (Compositae) auf der Iberischen Halbinsel. Ruizia 10: 1–261.
CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Vogt, R. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Nagl, W. & F. Ehrendorfer. 1974. DNA content, heterochromatin, mitotic index and growth in perennial and annual Anthemideae (Asteraceae). Pl. Syst. Evol. 123: 35–54.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979a. Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Zhurn. SSSR 64 (4): 582–589.
CCDB · ipcn-api-dl — Teppner, H. 1980. Karyologie und systematik einiger Gefabpilanzen der Ostalpen. Phyton (Horn) 20: 73–94.
CCDB · ipcn-api-dl — Probatova, N. S. 2000. Chromosome numbers in some plant species from the Razdolnaya (Suifun) river basin (Primorsky Territory). Bot. Žhurn. (Moscow & Leningrad) 85(12): 102–107.
CCDB · ipcn-api-dl — Gregor, T. & R. Hand. 2009. Chromosomenzahlen von Farn- und Samenpflanzen aus Deutschland 4. Kochia 4: 37–46.
CCDB · ipcn-api-dl — Zeleny, V. 1974. B-chromosomes of Leucanthemum (Asteraceae) in Czechoslovakia. Pl. Syst. Evol. 123: 55–60.
CCDB · ipcn-api-dl — Taniguchi, K., R. Tanaka, Y. Yonezawa & H. KOMATSU. 1975. Types of banding patterns of plant chromosomes by modified BSG method. Kromosomo, II 100: 3123–3135.
CCDB · ipcn-api-dl — Favarger, C. 1975b. Sur quelques marguerites d'Espagne et de France (Etude cytotaxonomique). Anales Inst. Bot. Cavanilles 32: 1209–1243.
CCDB · book-ipcn66 — Polatschek 1966
CCDB · book-ipcn67-71 — LARSEN, K., & s. LAGAARD. 1971. Chromosome studies of the Sicilian flora. Bot. Tidsskr. 66: 2Q9-268.
CCDB · book-ipcn67-71 — MIRKOVIC, D. 1966. Cytotaxonomical investigations of species of the genus Leucanthemum Adans. em. Briq. et. Cav. from Yugoslavia. Act. Bot. Croat. 25: 137-152.
+23 more references
2n 3652×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +12
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — FAVARGER C., VILLARD M. - 1965. Nouvelles recherches cytotaxonomiques sur Chrysanthemum leucanthemum L. sensu lat.. Bull. Soc. Bot. Suisse , 75: 57-79.
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · ita-fl — FAVARGER C. - 1972. Contribution l'tude cytotaxonomique de la flore des Apennins. I.. Bull. Soc. Neuchateloise Sci. Nat. , 95: 1/11/1934.
CCDB · iapt — IAPT/IOPB Chromosome Data 14
CCDB · brit-fl — Pearson, P.L. (1967)
CCDB · fl-europaea — Mirkovic, 1966
CCDB · poland — Skali?ska M., Piotrowicz M., Soko?owska-Kulczycka A. et al. 1961. Further additions to chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 30, 463-489.
CCDB · poland — Przywara L. 1974. Karyological studies on Leucanthemum vulgare s.l. from Poland. Acta Biol. Cracov. Ser. Bot. 17, 55-73.
CCDB · book-ipcn65 — Larsen 1965b
CCDB · book-ipcn65 — Mehra et al. 1965
CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.
CCDB · ipcn-api-dl — BHATTACHARYYA, D. 1976. Chromosome study in the genus Chrysanthemum. Proc. Indian Sci. Congr. Assoc. 63: 118.
CCDB · ipcn-api-dl — BHATTACHARYYA, D. 1977. Caryomorphological studies in some species of the genus Chrysanthemum. Sci. & Cult. 43: 431–432.
CCDB · ipcn-api-dl — Marchi, P., O. Illuminati, A. Macioce, R. Capineri & G. D'Amato. 1983. Genome evolution and polyploidy in Leucanthemum vulgare Lam. aggr. (Compositae). Karyotype analysis and DNA microdensitometry. Caryologia 36: 1–18.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — D'Ovidio, R. 1984. Numeri cromosomici per la flora Italiana: 1011--1021. Inform. Bot. Ital. 16: 251–260.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1987. Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23–33.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1987. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II. Zapov. Belorussii Issl. 11: 62–69.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1991. Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR). Bot. Žhurn. (Moscow & Leningrad) 76: 473–476.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & L. G. Ulle. 1992. Kariologicheskie osobennosti i rasprostranenie predstavitelej semejstva Asteraceae v Pechoro--Ilychskom Biosfernom Zapovednike. Trudy Komi Nauchnogo Tsentra UrO AN SSSR 126: 52–64.
CCDB · ipcn-api-dl — Stepanov, N. V. & E. N. Muratova. 1995. Chromosome numbers of some taxa of higher plants of Krasnoyarsk territory. Bot. Žhurn. (Moscow & Leningrad) 80(6): 114–116.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., & E. KLIPHUIS. 1970. Cytotaxonomic investigations in some angiosperms collected in the Valley of Aosta and in the National Park "Gran Paradiso". Carylogia 23: 363-379.
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., & E. KLIPHUIS. 1970. Chromosome studies in some flowering plants collected in the French Alps (Hante Savoie). Rev. Gen. Bot. 77: 487-497.
CCDB · book-ipcn67-71 — MIRKOVIC, D. 1966. Cytotaxonomical investigations of species of the genus Leucanthemum Adans. em. Briq. et. Cav. from Yugoslavia. Act. Bot. Croat. 25: 137-152.
CCDB · book-atlas-flowering-plants — Shimotomai 1937b
CCDB · kew — Band SR. (pers. comm. 1984).
CCDB · Cave1956 — Love & Love P
CCDB · Cave1963 — Gadella & Klip. 1963
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Moritz, R. S., Lubogoschinsky, P. I. & Sergeyeva, A. S. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:892-894
CCDB · CromoCat 2015 — Lippert, W. & Heubl, G.R. (1989). Chromosomenzahlen von Pflanzen aus Bayern und angrenzenden Gebieten: [Teil 2]. Ber. Bayer. Bot. Ges. 60: 73-83.
CCDB · CromoCat 2015 — Morton, J. K. (1981). Chromosome numbers in Compositae from Canada and the USA. Bot. J. Linn. Soc. 82: 357-368.
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Dmitrieva, S. A. (1987). Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23-33.
CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Kestenova, R. (1988). Variation in Leucanthemum vulgare group in Bulgaria. Karyological study. In: 100 ann. acad. N. Stojanov : 115-124.
CCDB · CromoCat 2015 — Lavrenko, A. N., Serditov, N. P. & Ulle, L. G. (1992). Kariologicheskie osobennosti i rasprostranenie predstavitelej semejstva Asteraceae v pechoro-Ilychskom Biosfernom Zapovednike Trudy Komi Naucnogo Tsentra Ur.O. A.N. S.S.S.R. 126: 52-64.
+8 more references
2n 5416×CCDB · ita-fl · CCDB · slov-fl · CCDB · fl-europaea +4
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · ita-fl — FAVARGER C., VILLARD M. - 1965. Nouvelles recherches cytotaxonomiques sur Chrysanthemum leucanthemum L. sensu lat.. Bull. Soc. Bot. Suisse , 75: 57-79.
CCDB · slov-fl — Baksay L., 1957a: The cytotaxonomy of the species Chrysanthemum maximum Ram., Centaurea montana L., Serratula lycopifolia (Vill.) Kern., and Bupleurum falcatum L., ranging in Europe. - Ann. Hist.-Nat. Mus. Natl. Hung. Series nova 8: 155-168.
CCDB · fl-europaea — Polatschek, 1966
CCDB · fl-europaea — Fernandes & Queiros,
CCDB · poland — Skali?ska M., Piotrowicz M., Soko?owska-Kulczycka A. et al. 1961. Further additions to chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 30, 463-489.
CCDB · poland — Skali?ska M. et al. 1964. Additions to chromosome numbers of Polish Angiosperms (Fifth contribution). Acta Soc. Bot. Pol. 33, 45-76.
CCDB · ipcn-api-dl — Parfitt, B. D. 1981. ln Chromosome number reports LXXI. Taxon 30: 515–516.
CCDB · CromoCat 2015 — Lippert, W. & Heubl, G.R. (1989). Chromosomenzahlen von Pflanzen aus Bayern und angrenzenden Gebieten: [Teil 2]. Ber. Bayer. Bot. Ges. 60: 73-83.
CCDB · CromoCat 2015 — Parfitt, B. D. (1981). ln Chromosome number reports LXXI. Taxon 30: 515-516.
CCDB · CromoCat 2015 — Loon van, J. C. & van Setten, A. K. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 589-592.
CCDB · iapt — IAPT/IOPB Chromosome Data 23
2n 728×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · fl-europaea +2
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — FAVARGER C. - 1972. Contribution l'tude cytotaxonomique de la flore des Apennins. I.. Bull. Soc. Neuchateloise Sci. Nat. , 95: 1/11/1934.
CCDB · fl-europaea — Favarger &
CCDB · kew — Siljak-Yakovlev S, Pustahija F, Šolic EM, Bogunic F, Muratovic E, Bašic N, Catrice O, Brown SC. 2010. Towards a genome size and chromosome number database of Balkan flora: C-values in 343 taxa with novel values for 242. Advanced Science Letters 3: 190-213
CCDB · CromoCat 2015 — Lippert, W. & Heubl, G.R. (1989). Chromosomenzahlen von Pflanzen aus Bayern und angrenzenden Gebieten: [Teil 2]. Ber. Bayer. Bot. Ges. 60: 73-83.
CCDB · CromoCat 2015 — Siljak-Yakovlev, S., Pustahija, F., Šoli?, E.M., Boguni?, F., Muratovi?, E., Baši?, N., Catrice, O. & S. C. Brown. (2010). Towards a Genome Size and Chromosome Number Database of Balkan Flora: C-Values in 343 Taxa with Novel Values for 242 Advanced Scienc
2n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Parfitt, B. D. (1981). ln Chromosome number reports LXXI. Taxon 30: 515-516.
CCDB · CromoCat 2015 — Morton, J. K. (1981). Chromosome numbers in Compositae from Canada and the USA. Bot. J. Linn. Soc. 82: 357-368.
2n 902×CCDB · fl-europaea · CCDB · Cave1962
CCDB · fl-europaea — Favarger &
CCDB · Cave1962 — Favarger 1962
2n 271×GoaT · DTOL Flowering Plants Estimates Kew
GoaT · DTOL Flowering Plants Estimates Kew
2n 451×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 23
2n 1081×CCDB · fl-europaea
CCDB · fl-europaea — Favarger &
n 916×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +3
CCDB · book-ipcn65 — Bostick 1965
CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979a. Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Zhurn. SSSR 64 (4): 582–589.
CCDB · ipcn-api-dl — Teppner, H. 1980. Karyologie und systematik einiger Gefabpilanzen der Ostalpen. Phyton (Horn) 20: 73–94.
CCDB · book-ipcn66 — Polatschek 1966
CCDB · book-ipcn67-71 — JONES, S.B. Jr. 1968. Chromosome numbers in southeastern United states Compositae II. Bull. Torrey Bot. Club 95: 488-489.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — POWELL, A.M., & R.M. KING. 1969. Chromosome numbers in the Compositae: Colombian species. Amer. J. Bot. 56: 116-121.
CCDB · book-ipcn67-71 — MIRKOVIC, D. 1966. Cytotaxonomical investigations of species of the genus Leucanthemum Adans. em. Briq. et. Cav. from Yugoslavia. Act. Bot. Croat. 25: 137-152.
CCDB · book-ipcn67-71 — VILLARD, M. 1970. Contribution a l'etude cytotaxinomique et cytogenetique du genre Leucanthemum Adans. em. Briq. et Cav. Bull. Soc. bot. Suisse 80: 96-187.
CCDB · Cave1959 — Mulligan 1959
CCDB · CromoCat 2015 — Parfitt, B. D. & N. A. Harriman. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXI]. Taxon 30(2): 515-516.
CCDB · CromoCat 2015 — Teppner, H. (1980). Karyologie und systematik einiger gefäpflanzen der Ostalpen. Phyton (Horn) 20: 73-94.
CCDB · CromoCat 2015 — Morton, J. K. (1981). Chromosome numbers in Compositae from Canada and the USA. Bot. J. Linn. Soc. 82: 357-368.
CCDB · CromoCat 2015 — Polatschek, A. (1965). Cytotaxonomische Beitrage zur Flora des Ostalpelander. Diss. Universität Wien pp. 130+X
CCDB · CromoCat 2015 — Polatschek, A. (1966b). Cytotaxonomische Beitrage zur Flora des Ostalpelander. II Österr. Bot. Z. 113(2): 101-147.
n 014×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Dmitrieva, S. A (2000). Karyology of the flora of Byelarus. 42 Thesis of the Diss. Doc. Biol. Sci. Minsk.
CCDB · CromoCat 2015 — Khandjian, N. S. (1975). New data on chromosome number in Tanacetum L. And Leucanthemum Mill. Biol. Zurn. Armen. 28: 87–89.
CCDB · CromoCat 2015 — Lippert, W. & Heubl, G.R. (1989). Chromosomenzahlen von Pflanzen aus Bayern und angrenzenden Gebieten: [Teil 2]. Ber. Bayer. Bot. Ges. 60: 73-83.
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Moritz, R. S., Lubogoschinsky, P. I. & Sergeyeva, A. S. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:892-894
CCDB · CromoCat 2015 — Morton, J. K. (1981). Chromosome numbers in Compositae from Canada and the USA. Bot. J. Linn. Soc. 82: 357-368.
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1988b). Pervichnyj citogeneticheskij monitoring flory Belorussii. Izvestiia Akademii Nauk Azerbaidzhanskoi SSR, Seriia Biologicheskikh Nauk 6: 8-11.
CCDB · CromoCat 2015 — Parfitt, B. D. (1981). ln Chromosome number reports LXXI. Taxon 30: 515-516.
CCDB · CromoCat 2015 — Zelený V. (1974). B-Chromosomen bei der Gattung Leucanthemum (Asteraceae) in der Tschechoslowakei. Plant. Syst. Evol. 123: 55-60
n 186×CCDB · ita-fl · CCDB · iapt · CCDB · book-ipcn67-71
CCDB · ita-fl — FAVARGER C. - 1972. Contribution l'tude cytotaxonomique de la flore des Apennins. I.. Bull. Soc. Neuchateloise Sci. Nat. , 95: 1/11/1934.
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · book-ipcn67-71 — SHETTY, B. V. 1967. In IOPB chromosome number reports XIV. Taxon 16: 552-571.
CCDB · book-ipcn67-71 — MIRKOVIC, D. 1966. Cytotaxonomical investigations of species of the genus Leucanthemum Adans. em. Briq. et. Cav. from Yugoslavia. Act. Bot. Croat. 25: 137-152.
CCDB · book-ipcn67-71 — VILLARD, M. 1970. Contribution a l'etude cytotaxinomique et cytogenetique du genre Leucanthemum Adans. em. Briq. et Cav. Bull. Soc. bot. Suisse 80: 96-187.
n 272×CCDB · ita-fl
CCDB · ita-fl — FAVARGER C., VILLARD M. - 1965. Nouvelles recherches cytotaxonomiques sur Chrysanthemum leucanthemum L. sensu lat.. Bull. Soc. Bot. Suisse , 75: 57-79.
n 361×CCDB · ita-fl
CCDB · ita-fl — FAVARGER C. - 1972. Contribution l'tude cytotaxonomique de la flore des Apennins. I.. Bull. Soc. Neuchateloise Sci. Nat. , 95: 1/11/1934.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
07Deep time~6 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin6 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type677 325 records
Wild obs. + sensor655 690
Museum / vouchered18 160
Cultivated / captive501
Other2 974
Origin
Native31 567
Introduced4 308
Range
Area of Occupancy AOO750 720 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy51% within 1 km
≤100 m 146 811≤1 km 133 942≤10 km 263 016>10 km 5 585
549 354 georeferenced · 106 336 without coordinates
Open the mapobservation + sensor655 690
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy52% within 1 km
≤100 m 3 109≤1 km 3 732≤10 km 5 833>10 km 428
13 102 georeferenced · 5 058 without coordinates
Open the institutions mapphysical evidence18 160
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy5% within 1 km
≤100 m 1≤1 km 1≤10 km 22>10 km 14
38 georeferenced · 463 without coordinates
Open the mapnot free-living501
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions232 of 421 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 5 219 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 477 |
| DBF-NHMDlocation not on record | 1 249 |
| Moscow State Universitylocation not on record | 494 |
| LDlocation not on record | 424 |
| Olocation not on record | 409 |
| BFLlocation not on record | 366 |
| Madison, US | 232 |
| TROMlocation not on record | 214 |
| Wuzhou, CN | 205 |
| Oskarshamn, SE | 195 |
| Oulu, FI | 171 |
| Bergen, NO | 167 |
| Trondheim, NO | 160 |
| Jyväskylä, FI | 156 |
| Berlin, DE | 150 |
| SLU Artdatabankenlocation not on record | 145 |
| Salzburg, AT | 123 |
| Montréal, CA | 114 |
| Uniwersytet Warszawskilocation not on record | 104 |
| Turku, FI | 102 |
| BDBClocation not on record | 100 |
| St. Paul, US | 97 |
| Victoria, CA | 95 |
| Bloomington, US | 87 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 83 |
| Kuopio, FI | 80 |
| Saint John, CA | 79 |
| Museo Entomologico de Leonlocation not on record | 79 |
| KMNlocation not on record | 78 |
| Canberra, AU | 76 |
| Saint Louis, US | 76 |
| Barcelona, ES | 75 |
| Ann Arbor, US | 71 |
| Acadia Universitylocation not on record | 69 |
| BRNUlocation not on record | 68 |
| Pullman, US | 67 |
| Odawara, JP | 67 |
| Mount Annan, AU | 62 |
| University of New Hampshirelocation not on record | 57 |
| Tartu, EE | 55 |
| Corvallis, US | 55 |
| Spearfish, US | 54 |
| Auckland, NZ | 53 |
| Green Bay, US | 52 |
| South Kensington, GB | 51 |
| Bangkok, TH | 50 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 50 |
| Burlington, US | 49 |
| Wlocation not on record | 48 |
| Logan, US | 48 |
| Denver, US | 47 |
| Nagano City, JP | 47 |
| Uniwersytet Opolskilocation not on record | 47 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 46 |
| Riverside, US | 45 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 44 |
| College Park, US | 42 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 41 |
| WTUlocation not on record | 40 |
| Porvoo, FI | 37 |
| Entomological Society of Latvialocation not on record | 37 |
| BClocation not on record | 34 |
| Hobart, AU | 34 |
| Helsinki, FI | 32 |
| Adelaide, AU | 32 |
| Christchurch, NZ | 31 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 31 |
| Chongqing Museumlocation not on record | 31 |
| Arcata, US | 30 |
| Bern, CH | 30 |
| Tula State Universitylocation not on record | 29 |
| University of Stellenboschlocation not on record | 29 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 29 |
| Mlocation not on record | 29 |
| MAlocation not on record | 29 |
| Garðabær, IS | 27 |
| Norfolk, US | 27 |
| Davis, US | 27 |
| Pittsburg, US | 26 |
| Chadron, US | 26 |
| Zürich, CH | 26 |
| GJOlocation not on record | 26 |
| Adam Mickiewicz University in Poznańlocation not on record | 24 |
| Albuquerque, US | 24 |
| Emporia, US | 23 |
| Wellington, NZ | 22 |
| Fukushima Universitylocation not on record | 22 |
| San Isidro, AR | 22 |
| Provincia di Livornolocation not on record | 22 |
| Kew, GB | 21 |
| Chapel Hill, US | 21 |
| Zürich, CH | 21 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 20 |
| Kochi, JP | 20 |
| Flagstaff, US | 20 |
| ASUlocation not on record | 19 |
| Vancouver, CA | 19 |
| Missoula, US | 19 |
| Tallinn, EE | 19 |
| TUR-Alocation not on record | 18 |
| Whitewater, US | 18 |
| Jackson, US | 18 |
| Armidale, AU | 18 |
| Moscow, US | 18 |
| Stockholm, SE | 17 |
| Madrid, ES | 17 |
| Herbario UTCEClocation not on record | 16 |
| Western Carolina Universitylocation not on record | 16 |
| Portland, US | 16 |
| McWane Science Centerlocation not on record | 16 |
| Canadian Department of Agriculturelocation not on record | 15 |
| Université Lavallocation not on record | 15 |
| Angwin, US | 15 |
| Görlitz, DE | 15 |
| Lord Fairfax Community Collegelocation not on record | 15 |
| UGentlocation not on record | 15 |
| Philadelphia, US | 14 |
| Uniwersytet Śląski w Katowicachlocation not on record | 14 |
| València, ES | 14 |
| Shinshu Universitylocation not on record | 14 |
| Toronto, CA | 13 |
| Salamanca, ES | 13 |
| Pretoria, ZA | 13 |
| Tsukuba, JP | 13 |
| CASlocation not on record | 13 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 13 |
| Dekalb, US | 13 |
| Beijing, CN | 13 |
| Bronx, US | 12 |
| Otaru, JP | 12 |
| Fayetteville, US | 12 |
| Rotorua, NZ | 12 |
| Brisbane, AU | 12 |
| CICYTEXlocation not on record | 12 |
| Kushiro City Museumlocation not on record | 12 |
| Pamplona, ES | 12 |
| Provo, US | 12 |
| Rovaniemi, FI | 12 |
| Boise, US | 11 |
| GB | 11 |
| Pamplona, ES | 10 |
| Kandalaksha State Nature Reservelocation not on record | 10 |
| Millersville, US | 10 |
| Springfield, US | 10 |
| Anchorage, US | 10 |
| Fairfax, US | 10 |
| Hudson, US | 9 |
| Williamsburg, US | 9 |
| Toyama, JP | 9 |
| Natural History Museum Rotterdamlocation not on record | 9 |
| GMBAlocation not on record | 9 |
| Córdoba, AR | 9 |
| IDElocation not on record | 9 |
| H-Schuhwlocation not on record | 9 |
| Kirksville, US | 9 |
| National Biodiversity Institute, Costa Ricalocation not on record | 9 |
| San Luis Obispo, US | 9 |
| Nijmegen, NL | 8 |
| Universidad de Caldas (UCaldas)location not on record | 8 |
| Hiratsuka City Museumlocation not on record | 8 |
| New Brunswick, US | 8 |
| Phoenix, US | 8 |
| Fredericksburg, US | 8 |
| Columbia, US | 8 |
| University of Tennessee at Chattanoogalocation not on record | 8 |
| Taipei, TW | 8 |
| Québec, CA | 8 |
| Rocky Mountain Biological Laboratorylocation not on record | 8 |
| College of the Atlantic, Museumlocation not on record | 8 |
| Pocatello, US | 8 |
| Karlsruhe, DE | 8 |
| Durban, ZA | 8 |
| Guangzhou, CN | 8 |
| GAlocation not on record | 7 |
| San Diego, US | 7 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 7 |
| 7 | |
| University of Guelph, OAC Herbariumlocation not on record | 7 |
| Uppsala, SE | 7 |
| MeiseBGlocation not on record | 7 |
| PrivatHerblocation not on record | 7 |
| Tacoma, US | 6 |
| Porrentruy, CH | 6 |
| WINlocation not on record | 6 |
| US | 6 |
| San Sebastián, ES | 6 |
| University of Alberta Museumslocation not on record | 6 |
| Dresden, DE | 6 |
| Mexico City, MX | 6 |
| Johnson City, US | 6 |
| Akita Prefectural Museumlocation not on record | 6 |
| Nagatoro-machi, Chichibu-gun, JP | 6 |
| Harrisonburg, US | 6 |
| Morgantown, US | 6 |
| Chicago, US | 6 |
| Jefferson City, US | 6 |
| USFS/BHSClocation not on record | 6 |
| Whitehorse, CA | 6 |
| Claremont, US | 6 |
| Lincoln, US | 5 |
| Clemson, US | 5 |
| San Angelo, US | 5 |
| Philadelphia, US | 5 |
| KURAlocation not on record | 5 |
| Paris, FR | 5 |
| SWlocation not on record | 5 |
| DOI/NPS, Greenbelt Parklocation not on record | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 5 |
| Durham, US | 5 |
| Zhengzhou, CN | 5 |
| Durango, MX | 5 |
| Bando, JP | 5 |
| KIRMlocation not on record | 5 |
| Orem, US | 5 |
| Podgorica, ME | 5 |
| University of British Columbia, Herbariumlocation not on record | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| PRClocation not on record | 5 |
| GZUlocation not on record | 5 |
| Sendai, JP | 4 |
| Jena Microbial Resource Collectionlocation not on record | 4 |
| Universidad Industrial de Santander (UIS)location not on record | 4 |
| Northridge, US | 4 |
| Tampa, US | 4 |
| Ypsilanti, US | 4 |
| Vitoria, ES | 4 |
| Asheville, US | 4 |
| Tilburg, NL | 4 |
| Frankfurt am Main | 4 |
| Fort Worth, US | 4 |
| Korea National Arboretumlocation not on record | 4 |
| Fulda, DE | 4 |
| Austin, US | 4 |
| UChlocation not on record | 4 |
| Caldwell, US | 4 |
| Fargo, US | 4 |
| Universidad Nacional de Colombia (UNAL)location not on record | 4 |
| Granada, ES | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| Iwate Prefectural Museumlocation not on record | 4 |
| OLAlocation not on record | 4 |
| Mississippi State, US | 4 |
| Laboratory of Palaeontologylocation not on record | 4 |
| CJBGlocation not on record | 4 |
| Salvador, BR | 3 |
| Universidad de Antioquia (UdeA)location not on record | 3 |
| CZE096location not on record | 3 |
| NoColllocation not on record | 3 |
| Davenport, US | 3 |
| Palmerston North, NZ | 3 |
| Little Rock, US | 3 |
| Mohonk Preservelocation not on record | 3 |
| Tomioka, JP | 3 |
| BSBIlocation not on record | 3 |
| DASSHlocation not on record | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Tapachula, MX | 3 |
| Bourges, FR | 3 |
| Tokushima, JP | 3 |
| Baltimore, US | 3 |
| Dhaka, BD | 3 |
| Forssa, FI | 3 |
| Memorial University of Newfoundlandlocation not on record | 3 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| BGBMlocation not on record | 3 |
| AUAlocation not on record | 3 |
| San José, CR | 3 |
| Richmond, US | 3 |
| Lausanne, CH | 3 |
| Nishihara, JP | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Philadelphia, US | 2 |
| Omachi Alpine Museumlocation not on record | 2 |
| Cape Town, ZA | 2 |
| Glarus, CH | 2 |
| Xiamen, CN | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| Badajoz, ES | 2 |
| Smithsonian Institutionlocation not on record | 2 |
| Tulane Universitylocation not on record | 2 |
| UoB-IBlocation not on record | 2 |
| Santa Barbara, US | 2 |
| Valparaiso, CL | 2 |
| CJBNlocation not on record | 2 |
| Alicante, ES | 2 |
| Henderson State Universitylocation not on record | 2 |
| Guatemala City, GT | 2 |
| LINUlocation not on record | 2 |
| National Botanic Garden of Waleslocation not on record | 2 |
| Monastir, TN | 2 |
| Corrientes, AR | 2 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 2 |
| Dover, US | 2 |
| ISAlocation not on record | 2 |
| University of Southern Mississippilocation not on record | 2 |
| USFSlocation not on record | 2 |
| Universiti Sains Malaysialocation not on record | 2 |
| Kingston, US | 2 |
| Yangling, CN | 2 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 2 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 2 |
| Institute of the biological problems of the North FEB RASlocation not on record | 2 |
| Macomb, US | 2 |
| Grand Junction, US | 2 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 2 |
| IWEP FEB RASlocation not on record | 2 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 2 |
| Bothell, US | 2 |
| Durango, US | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| New Mexico Museum of Natural History and Sciencelocation not on record | 2 |
| EL PASO, US | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| HJAEFlocation not on record | 2 |
| Taipei, TW | 2 |
| SZUlocation not on record | 1 |
| Cascavel, BR | 1 |
| JP | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Edinburgh, GB | 1 |
| Oswego, US | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Ivano-Frankivsk, UA | 1 |
| Hazara Universitylocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| Tuscaloosa, US | 1 |
| Kiritappu Wetland National Trustlocation not on record | 1 |
| Museo civico di Ecologia e Storia naturale di Marano sul Panarolocation not on record | 1 |
| Namur, BE | 1 |
| Durham, US | 1 |
| Wollongong, AU | 1 |
| QVMAGlocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Nishihara, JP | 1 |
| Wuhan, CN | 1 |
| Brookings, US | 1 |
| München, DE | 1 |
| H-Dueringlocation not on record | 1 |
| Minia, EG | 1 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| Kawasaki Shi Tama Ku, JP | 1 |
| STNFlocation not on record | 1 |
| Kagoshima, JP | 1 |
| Kunming, CN | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Miami, US | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| Irvine, US | 1 |
| Tempe, US | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| UTPLlocation not on record | 1 |
| Firenze, IT | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| University of Genevalocation not on record | 1 |
| Sapporo, JP | 1 |
| CUVClocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Guasave, MX | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| Jardín Botánico Nacional Dr. Rafael M. Moscosolocation not on record | 1 |
| BMlocation not on record | 1 |
| Gijón, ES | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Yukon Universitylocation not on record | 1 |
| University of Wisconsinlocation not on record | 1 |
| Honolulu, US | 1 |
| China Agricultural Universitylocation not on record | 1 |
| UMKClocation not on record | 1 |
| QCNElocation not on record | 1 |
| Sagamihara, JP | 1 |
| Calabar, NG | 1 |
| Universidad Icesi (ICESI)location not on record | 1 |
| INTAlocation not on record | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Montréal, CA | 1 |
| Antiguo Cuscatlán, SV | 1 |
| *unvoucheredlocation not on record | 1 |
| UEMlocation not on record | 1 |
| Banyoles, ES | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| US | 1 |
| TAIElocation not on record | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Washington, US | 1 |
| BISHlocation not on record | 1 |
| Ishikawa Museum of Natural Historylocation not on record | 1 |
| LPMMBHlocation not on record | 1 |
| nbflocation not on record | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| UNINE:NEUlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Henderson, US | 1 |
| Zapopan, MX | 1 |
| Ashland, US | 1 |
| Cheney, US | 1 |
| Brown Universitylocation not on record | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| EEZA-CSIClocation not on record | 1 |
| New Haven, US | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Riobamba, EC | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 1 |
| Jaén, ES | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Göteborg, SE | 1 |
| Santa Cruz, US | 1 |
| Brussel, BE | 1 |
| JBRJlocation not on record | 1 |
| La Trobe Universitylocation not on record | 1 |
421 institutions · 16 860 of 18 160 vouchered records shown · 1 087 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA43 detections
Where the DNA of Leucanthemum vulgare was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found43
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 43 detections have coordinates
Open the map8 countries0
Along roadside.Growing along edge of highway pavement in ro…abandoned prairie, rockyOld field.subalpine moist meadowmeadow
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.2 °C 5.30–19.1
Seasonal swing summer↔winter23.8 °C
Max temp (day)18.7 °C 10.4–23.5
Min temp (night)10.4 °C 1.20–15.5
Precipitation78.3 mm/mo 53.5–108
Air humidity60.3 % 54.3–63.5
Moisture balance-28.0 mm/mo -86.1–21.7
Vapour deficit669 Pa 447–917
Wind speed2.90 m/s 1.70–4.60
Cloud cover43.5 % 35.9–52.0
CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.