Leucangium carthusianum

(Tul. & C.Tul.) Paol. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Pezizomycetes/Pezizales/Morchellaceae/Leucangium

At a glance

Occurrence records39

Data sources9

Biological traits0

DNA specimens2

eDNA detections8

Sources9 archives

Databases and archives Leucangium carthusianum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility39 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.11 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF39 records

Environmental DNA3 datasets · 3 countries8 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT114 Mbp

01Narrative

Leucangium carthusianum is a species of ascomycete fungus. It is commonly known as the Oregon black truffle. It is found in the Pacific Northwest region of North America, where it grows in an ectomycorrhizal association with Douglas-fir. It is commercially collected, usually assisted by a specially trained truffle dog. Mature fruiting bodies can be dug up mostly during winter, but the season can extend from September through April.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Leucangium carthusianum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences10

eDNA detections8

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPQ409139.1 ↗653 bpUSA · 2023

ACGT

TTGTAGCTTCGCTAGGGGGGTGGACCCAAACAAAGGTTCAAAGACAACCGGGAGGACCCACGTCACACCTGCCAGCCGGTGCGGCACCCC …

Leucangium carthusianum voucher CS44 CSNM iNaturalist#161754851 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Leucangium carthusianum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size114 190 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Leucangium carthusianum0.11 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type39 records

Wild obs. + sensor28

Museum / vouchered11

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 2≤1 km 2≤10 km 18>10 km 6

28 georeferenced

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 1≤10 km 5

6 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	2
WU-MYClocation not on record	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1

4 institutions · 5 of 11 vouchered records shown · 5 without an institution code

09Environmental DNA8 detections

Where the DNA of Leucangium carthusianum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys3

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

under Pseudotsuga menziesii

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-2.00 °C -2.00–11.8

Seasonal swing summer↔winter32.7 °C

Max temp (day)-0.3 °C -0.3–14.6

Min temp (night)-4.90 °C -4.90–9.20

Precipitation100 mm/mo 75.6–192

Air humidity58.0 % 58.0–63.1

Moisture balance73.5 mm/mo 14.2–131

Vapour deficit223 Pa 223–502

Wind speed3.30 m/s 2.60–3.50

Cloud cover49.0 % 46.1–49.4

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)