Lethotremus muticus

Gilbert, 1896 · species

image placeholder — illustration coming later

Animalia/Chordata/Scorpaeniformes/Cyclopteridae/Lethotremus

At a glance

Occurrence records508

Data sources7

Biological traits7

DNA specimens33

eDNA detections0

Sources7 archives

Databases and archives Lethotremus muticus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility185 records↗

OBISOcean Biodiversity Information System323 records↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS508 records

DNA & barcodingBOLD33 specimens

01Narrative

Lethotremus muticus, also known as the docked snailfish (a somewhat misleading name as this species is not one of the true snailfish in the family Liparidae), is a species of lumpfish native to the Northeast Pacific. It is known from the Bering Sea and the Aleutian Islands, where its range extends to Unimak Pass, and it occurs at a depth range of 58 to 330 m (190 to 1082 ft). It is a benthic species that reaches 11.5 cm (4.5 inches) in total length. It can be found on substrates of mud, rock, or gravel, and it is currently the only known species of Lethotremus, following a reclassification of the second described species in the genus as Eumicrotremus awae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length11.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max330 m

Depth min58 m

Vulnerability10

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lethotremus muticus has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P569 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

51Gmostly conserved

GTGGGGACAGGCCTAAGCCTTTTAATTCGGGCCGAGCTAAGCCAGCCCGGGGCCCTCCTGGGCGACGACCAAATTTACAATGTAATTGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.08%

Haplotypes8

BIN1

Most divergent pair0.35%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eumicrotremus terraenovaesame family3.0%Eumicrotremus taranetzisame family3.4%Eumicrotremus orbissame family3.5%Eumicrotremus derjuginisame family7.0%Aptocyclus ventricosussame family8.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type508 records

Wild obs. + sensor10

Museum / vouchered498

Origin

Native143

Range

Area of Occupancy AOO608 km²

Depth

0–200 m sunlit152

200–1000 m twilight2

1–4 km midnight1

>4 km abyssal0

median 0 m · max 1 830 m · 155 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 498 records without

Open the institutions mapphysical evidence498

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UWFClocation not on record	141
Edmonton, CA	10
CASlocation not on record	4
Washington, US	4
ArcODlocation not on record	4
Vancouver, CA	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
University of California San Diegolocation not on record	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Wuzhou, CN	2
Texas Cooperative Wildlife Collectionlocation not on record	2
FishBaselocation not on record	1
Oregon State Universitylocation not on record	1

13 institutions · 180 of 498 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)