Lethariella canariensis

(Ach.) Krog · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Lecanorales/Parmeliaceae/Lethariella

At a glance

Occurrence records81

Data sources7

Biological traits0

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Lethariella canariensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility81 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Chemical compositionLOTUS · NPASS13 compounds

Occurrence & distributionGBIF81 records

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition13 compounds

Compounds documented for Lethariella canariensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Isoflavones5

Naphthoquinones2

Simple phenolic acids1

Flavanones1

Flavan-3-ols1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
(2S)-5-hydroxy-2-(2-hydroxy-4-methoxyphenyl)-8,8-dimethyl-6-(3-methylbut-2-enyl)-2,3-dihydropyrano[2,3-h]chromen-4-one	present	NPASS
2'-Hydroxygenistein	present	NPASS
3,5,7-trihydroxy-2-(4-hydroxy-3,5-dimethoxyphenyl)-6-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]chromen-4-one	present	NPASS
5,8-Dihydroxy-2-methyl-4H-naphtho[2,3-b]pyran-4,6,9-trione	present	LOTUS
6-(1,1-Dimethylallyl)genistein	present	NPASS
D-Arabitol	present	LOTUS
Daidzin	present	NPASS
ent-Gallocatechin 4'-methyl ether	present	NPASS
Genistein	present	NPASS
Genistin	present	NPASS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lethariella canariensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF297745.1 ↗546 bp

ACGT

AGGATCATTACCGAGAGAGGGGCCTCGCGCCCCCGGGGGTCTCGGCCCCCAACTCTTCACCCATTGCCTACCTACCTTTGTTGCTTTGGC …

Lethariella canariensis small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type81 records

Wild obs. + sensor11

Museum / vouchered70

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 4≤1 km 2>10 km 1

7 georeferenced · 4 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 3≤1 km 6≤10 km 12

21 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence70

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	10
Durham, US	8
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	7
Olocation not on record	5
US	5
Madison, US	5
PHlocation not on record	5
MeiseBGlocation not on record	5
Berlin, DE	3
M-Lichenslocation not on record	3
ASUlocation not on record	3
Uppsala, SE	3
MAlocation not on record	2
Museo Achille Folettolocation not on record	2
Chicago, US	1
Bergen, NO	1
Wlocation not on record	1
BClocation not on record	1

18 institutions · 70 of 70 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)