Leratiomyces percevalii

(Berk. & Broome) Bridge & Spooner · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Strophariaceae/Leratiomyces

At a glance

Occurrence records4 978

Data sources8

Biological traits0

DNA specimens25

eDNA detections25

Sources8 archives

Databases and archives Leratiomyces percevalii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 978 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 978 records

Environmental DNA1 datasets · 2 countries25 detections

DNA & barcodingBOLD · NCBI25 specimens

01Narrative

De houtsnipperstropharia is een schimmel die behoort tot de familie Strophariaceae. Hij leeft saprotroof in humus en op houtsnippers, veelal op wat ruderale plekken in parken en plantsoenen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Leratiomyces percevalii has left across the world's sequence archives.

At a glance

DNA specimens25

Marker genes2

GenBank sequences10

eDNA detections25

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPZ356100.1 ↗301 bpUSA · 1979

ACGT

GAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTTTTATCTTTATTGATAAAATG …

Leratiomyces percevalii clone 3291 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type4 978 records

Wild obs. + sensor4 819

Museum / vouchered159

Range

Area of Occupancy AOO7 432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 3 105≤1 km 387≤10 km 276>10 km 223

3 991 georeferenced · 828 without coordinates

Open the mapobservation + sensor4 819

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 25≤1 km 74≤10 km 13>10 km 2

114 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence159

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	29
Helsinki, FI	20
California State University, East Baylocation not on record	17
TROMlocation not on record	16
Trondheim, NO	12
SLU Artdatabankenlocation not on record	9
Göteborg, SE	5
Karlsruhe, DE	4
Denver, US	2
Chicago, US	2
Copenhagen, DK	2
Turku, FI	1
Lane Community College, Herbariumlocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
Universidade de Lisboa, Museu Bocagelocation not on record	1

15 institutions · 122 of 159 vouchered records shown · 37 without an institution code

09Environmental DNA25 detections

Where the DNA of Leratiomyces percevalii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map2 countries0

WetlandForestUrban/disturbed/developedOther

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 8.80–18.8

Seasonal swing summer↔winter18.4 °C

Max temp (day)21.9 °C 15.0–26.2

Min temp (night)7.90 °C 4.00–11.9

Precipitation19.4 mm/mo 7.00–66.7

Air humidity48.7 % 40.7–56.2

Moisture balance-123 mm/mo -157–-38.8

Vapour deficit878 Pa 573–1,217

Wind speed2.20 m/s 1.10–3.90

Cloud cover25.9 % 13.4–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Leratiomyces percevalii

At a glance

Sources8 archives

At a glance

Record type4 978 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 978 records