Leptospermum anfractum — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Leptospermum

At a glance

Occurrence records40

Data sources5

Biological traits5

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Leptospermum anfractum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility40 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF40 records

DNA & barcodingNCBIsequences

01Narrative

Leptospermum anfractum is a species of spreading shrub that is endemic to Queensland. It has a smooth, twisted trunk, linear leaves, white flowers borne in leaf axils and bell-shaped to hemispherical fruit. It grows on rocky ridges and cliff edges.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraits

Life cycle & reproduction1

Life spanperennial

Habitat & environment4

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Leptospermum anfractum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

matKOM752359.1 ↗2 496 bpAustralia

ACGT

AGTGCGGCTAGCATCTTTTACACATTTATATGAAGTAACGGATTCGTTCATACCTTCGGTAGAGTTTGTAAGACCACGACTGATCCTGAA …

Leptospermum anfractum isolate D1958 trnK gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1

plant barcode

08Occurrence & distribution

Record type40 records

Museum / vouchered38

Other2

Origin

Native8

Range

Area of Occupancy AOO80 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 10≤1 km 1≤10 km 17>10 km 2

30 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence38

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	24
Mount Annan, AU	8
Smithfield, AU	5
Canberra, AU	1

4 institutions · 38 of 38 vouchered records shown