Leptophlebia marginata

(Linnaeus, 1767) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Ephemeroptera/Leptophlebiidae/Leptophlebia

At a glance

Occurrence records15 833

Data sources7

Biological traits2

DNA specimens74

eDNA detections52

Sources7 archives

Databases and archives Leptophlebia marginata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 833 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics74 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF15 833 records

Environmental DNA3 datasets · 4 countries52 detections

DNA & barcodingBOLD74 specimens

01Narrative

Subimago of L. marginata Leptophlebia marginata, the sepia dun, is a species of mayfly in the family Leptophlebiidae. It is native to Europe and North America where it is distributed widely near lakes, ponds and slow-moving streams. The larvae, which are known as nymphs, are aquatic.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)does not feed

Feeding guild (larval)saprophagous

05DNA & barcoding74 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Leptophlebia marginata has left across the world's sequence archives.

At a glance

DNA specimens74

BINs2

Marker genes1

eDNA detections52

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

21Cmostly conserved

22Tmostly conserved

23Amostly conserved

198Gmostly conserved

342Amostly conserved

554Tmostly conserved

576Amostly conserved

CATAAAGATATTGGAACCCTCTATTTTATCTTTGGTGCCTGGGCTGGCATGGTTGGTACCTCACTTAGACTACTAATCCGAGCCGAACTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.59%

Haplotypes6

BIN1

Most divergent pair0.77%

Europe

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_060539 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND5ND4ND4LND6CYTBND1ND2COX1COX2ATP8ATP6COX3ND316S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type15 833 records

Wild obs. + sensor8 448

Museum / vouchered7 385

Origin

Native154

Range

Area of Occupancy AOO21 464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 4 682≤1 km 243≤10 km 320

5 245 georeferenced · 3 203 without coordinates

Open the mapobservation + sensor8 448

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 6 327≤1 km 320≤10 km 477>10 km 16

7 140 georeferenced · 245 without coordinates

Open the institutions mapphysical evidence7 385

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	1 726
NTNU-VMlocation not on record	430
Kuopio, FI	364
Adam Mickiewicz University in Poznańlocation not on record	90
Helsinki, FI	86
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	84
Tromsø, NO	76
WAGNlocation not on record	63
NHMOlocation not on record	31
BioFokuslocation not on record	30
South Kensington, GB	23
Natural History Museum, Londonlocation not on record	21
ZMAAlocation not on record	15
Provincia di Livornolocation not on record	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Paris, FR	4
Bavarian State Collection of Zoologylocation not on record	3
NTNU University Museum, Department of Natural Historylocation not on record	2
Dhaka, BD	2
Karlstads Universitetlocation not on record	2
Tartu, EE	1
Rovaniemi, FI	1
ZSMlocation not on record	1
Montréal, CA	1

24 institutions · 3 064 of 7 385 vouchered records shown · 4 321 without an institution code

09Environmental DNA52 detections

Where the DNA of Leptophlebia marginata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found52

Studies independent surveys3

Countries4

Verifiable raw sequence linked10

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 52 detections have coordinates

Open the map4 countries0

2nd order headwater stream draining in agric…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.30 °C 2.50–13.4

Seasonal swing summer↔winter24.8 °C

Max temp (day)12.4 °C 5.20–16.5

Min temp (night)5.10 °C -0.7–8.70

Precipitation67.7 mm/mo 48.1–86.6

Air humidity59.3 % 56.7–65.4

Moisture balance-13.3 mm/mo -40.2–23.1

Vapour deficit465 Pa 330–668

Wind speed2.50 m/s 2.40–3.60

Cloud cover52.5 % 42.1–58.1

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Leptophlebia marginata

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type15 833 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type15 833 records