Leptidea amurensis

(Ménétriés, 1859) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Leptidea

At a glance

Occurrence records328

Data sources8

Biological traits0

DNA specimens36

eDNA detections35

Sources8 archives

Databases and archives Leptidea amurensis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility328 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF328 records

Environmental DNA1 datasets · 3 countries35 detections

DNA & barcodingBOLD36 specimens

Genome at a glanceGoaT2n = 128

01Narrative

Leptidea amurensis is a butterfly of the family Pieridae. It is found from western Siberia to the Ussuri region and in North Korea, China, Mongolia and Japan. The larvae feed on Hedysarum ussuriense, Lupinus species and Vicia amoena.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Leptidea amurensis has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes2

eDNA detections35

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P639 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

166Avariable

474Gvariable

542Tvariable

619Avariable

AACTTTATATTTTATCTTTGGAATTTGAGCTGGAATAGTAGGGACTTCATTAAGTTTATTAATTCGAACAGAATTAGGAAACCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.35%

Haplotypes7

BIN1

Most divergent pair0.78%

EuropeOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Leptidea morseisame genus4.7%Leptidea realisame genus5.0%Leptidea sinapissame genus5.0%Leptidea darvazensissame genus5.2%Leptidea juvernicasame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Leptidea amurensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 128 n = 64

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 611×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

2n 1281×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type328 records

Wild obs. + sensor140

Museum / vouchered188

Range

Area of Occupancy AOO736 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 33≤1 km 10≤10 km 9>10 km 18

70 georeferenced · 70 without coordinates

Open the mapobservation + sensor140

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 2≤1 km 20≤10 km 28>10 km 58

108 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence188

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Obihiro Centennial City Museumlocation not on record	46
Helsinki, FI	44
Cambridge, US	25
Tartu, EE	20
New Haven, US	8
Natural History Museum Rotterdamlocation not on record	8
Zürich, CH	7
Shiojiri City Museum of Natural Historylocation not on record	6
Natural History Museum of Utahlocation not on record	4
NSMKlocation not on record	4
Denver, US	2
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	2
MJINlocation not on record	2
Gyeryonsan Natural History Museumlocation not on record	1
Philadelphia, US	1
McGuire Center for Lepidoptera and Biodiversitylocation not on record	1

16 institutions · 181 of 188 vouchered records shown · 7 without an institution code

09Environmental DNA35 detections

Where the DNA of Leptidea amurensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 13.2–17.9

Seasonal swing summer↔winter36.0 °C

Max temp (day)20.9 °C 18.3–22.9

Min temp (night)9.70 °C 6.80–12.2

Precipitation66.4 mm/mo 42.6–106

Air humidity56.6 % 52.0–59.1

Moisture balance-44.8 mm/mo -69.5–-6.00

Vapour deficit859 Pa 626–899

Wind speed2.50 m/s 1.70–3.60

Cloud cover40.5 % 34.8–44.1

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)