Lepinia taitensis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Lepinia

At a glance

Occurrence records21

Data sources8

Biological traits9

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Lepinia taitensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF21 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Lepinia taitensis is a species of plant in the family Apocynaceae. It is endemic to French Polynesia and classified as critically endangered by the IUCN.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lepinia taitensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLAJ419746.1 ↗1 445 bp

ACGT

AAGTGTTGGATTCAAAGCCGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGC …

Lepinia taitensis chloroplast partial rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, specimen voucher Perlman 15071, NTBG

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1

plant barcode

08Occurrence & distribution

Record type21 records

Museum / vouchered21

Range

Area of Occupancy AOO36 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence21

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	15
Bronx, US	2
University of Stellenboschlocation not on record	2
Honolulu, US	1
Gump Stationlocation not on record	1

5 institutions · 21 of 21 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Lepinia taitensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.