Lepidium latipes

Hook. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Lepidium

At a glance

Occurrence records429

Data sources7

Biological traits10

DNA specimens3

eDNA detections2

Sources7 archives

Databases and archives Lepidium latipes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility429 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF429 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Lepidium latipes is a species of flowering plant in the mustard family known by the common name San Diego pepperweed. It is native to California and Baja California, where it grows in alkaline soils in a number of habitat types.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lepidium latipes has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAJ582416.1 ↗267 bpUSA

ACGT

TCGATACCTGTCCAAAACAGAACGACCCGCGAACCAACTATCATCACTTGCGGTGGGCCGGTTTCCTAGCAGATCCCGTGTCCTCCGAAT …

Lepidium latipes internal transcribed spacer 1 (ITS1), specimen voucher Davis 37209

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcLa★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type429 records

Wild obs. + sensor51

Museum / vouchered254

Other124

Origin

Native17

Range

Area of Occupancy AOO720 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 33≤1 km 2>10 km 2

37 georeferenced · 14 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 22≤1 km 57≤10 km 55>10 km 4

138 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence254

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Davis, US	45
Santa Barbara, US	34
Riverside, US	33
San Diego, US	25
Claremont, US	20
CASlocation not on record	19
Canadian Department of Agriculturelocation not on record	6
Angwin, US	3
Arcata, US	3
US	3
Phoenix, US	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
San Luis Obispo, US	2
Mississippi State, US	1
Saint Louis, US	1
Northridge, US	1
University of Stellenboschlocation not on record	1
Kew, GB	1
Catalina Island Conservancylocation not on record	1
Los Angeles, US	1
Zürich, CH	1
Severin-McDaniel Insect Collectionlocation not on record	1
Bloomington, US	1
Mexico City, MX	1
Santa Cruz, US	1

25 institutions · 209 of 254 vouchered records shown · 44 without an institution code

09Environmental DNA2 detections

Where the DNA of Lepidium latipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)