Lepidium foliosum

Desv. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Lepidium

At a glance

Occurrence records585

Data sources5

Biological traits34

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Lepidium foliosum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility585 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Occurrence & distributionGBIF585 records

DNA & barcodingNCBIsequences

01Narrative

Lepidium foliosum, commonly known as leafy peppercress, is a shrubby species of plant found in southern regions of Australia, usually close to the coast. The herbaceous species is shrubby in form, with hairless leaves and stem, and resembles others plants of the mustard family Brassicaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit length5.25 mm

Fruit width3 mm

Leaf length40 mm

Leaf length max40 mm

Leaf width6 mm

Leaf width max10 mm

Leaf width min3 mm

Plant height0.3 m

Plant height max0.6 m

Plant height min0.15 m

Seed length5 mm

Seed mass0.77 mg

Seed width1 mm

Life cycle & reproduction7

Dispersal typeself

Flowering timennnnynnnnnnn

Life formperennial

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typesilique

Growth formshrub

Leaf compoundnesssimple

Leaf shapeoblanceolate obovate triangular

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lepidium foliosum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSKC109338.1 ↗613 bp

ACGT

TCGATACCTGTCCAAAACAGAACGACCCGCGAACCAACTATCATCACTTGCGGTGGGCCGGTTTCTTAGCTGATTCCGTGCCCGCCGAAT …

Lepidium foliosum voucher HO525314 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type585 records

Wild obs. + sensor184

Museum / vouchered248

Other153

Origin

Native118

Range

Area of Occupancy AOO1 188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 12≤1 km 117≤10 km 47>10 km 6

182 georeferenced · 2 without coordinates

Open the mapobservation + sensor184

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 5≤1 km 85≤10 km 106>10 km 25

221 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence248

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	60
Adelaide, AU	57
Museo Entomologico de Leonlocation not on record	55
Canberra, AU	27
Kensington, AU	21
Mount Annan, AU	10
QVMAGlocation not on record	7
Parkville, AU	2
Brisbane, AU	2
Kew, GB	1
MAlocation not on record	1
China Agricultural Universitylocation not on record	1
Brookings, US	1

13 institutions · 245 of 248 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)