Lepidium campestre
(L.) W.T.Aiton · speciesAt a glance
Occurrence records43 818
Data sources11
Biological traits55
DNA specimens36
eDNA detections15
Sources11 archives
Databases and archives Lepidium campestre's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility43 818 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics36 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources55 traits
Chemical compositionNPASS18 compounds
Occurrence & distributionGBIF43 818 records
Environmental DNA1 datasets · 5 countries15 detections
DNA & barcodingBOLD · NCBI36 specimens
Genome at a glanceCCDB · GoaT · NCBI225 Mbp
01Narrative
Lepidium campestre, la Passerage des champs, Nasitort ou Bourse-de-Judas, est une espèce de plantes herbacées de la famille des Brassicacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology19
Fruit length5.5 mm
⚠ sources differ — AusTraits: 5.5 mm · GIFT: 6 mm
Fruit width4 mm
Leaf length65 mm
Leaf length max70 mm
Leaf mass22.34 mg
Leaf size416 mm²
Leaf width5 mm
⚠ sources differ — AusTraits: 5 mm · GIFT: 6 mm
Leaf width max7 mm
Leaf width min3 mm
Plant height0.296 m
⚠ sources differ — GIFT: 0.296 m · AusTraits: 0.4 m · LEDA: 0.285 m · TRY: 0.433 m
Plant height generative0.27 m
Plant height max0.6 m
Plant height min0.15 m
Seed length2.24 mm
Seed length max2.3 mm
Seed length min2.3 mm
Seed mass2.23 mg
⚠ sources differ — TRY: 2.23 mg · LEDA: 2.5 mg · GIFT: 2.22 mg
Seed mass max2.5 mg
Seed mass min1.5 mg
Life cycle & reproduction15
Deciduousnesshibernal
⚠ sources differ — TRY: hibernal · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeanimal
Flowering endJul
Flowering startApr
Life formannual or biennial
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual biennial · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: annual
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number866
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 100 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typesilique
⚠ sources differ — AusTraits: silique · GIFT: capsule
Growth formherb
Habitat GIFTforest edges, roadsides, stony places
Leaf compoundnesssimple
Leaf shapenarrowly_triangular obovate ovate
Mycorrhiza type0.033769027
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)179 mg/g
⚠ sources differ — TRY: 179 mg/g · LEDA: 207 mg/g
Photosynthetic pathwayC3
Seed longevity index0.25
Specific leaf area (SLA)22.59 mm²/mg
⚠ sources differ — TRY: 22.59 mm²/mg · LEDA: 25.3 mm²/mg · GIFT: 25.31 mm²/mg
Other traits2
Diaspore typeone-seeded generative dispersule
Shoot orientationerect
03Chemical composition18 compounds
Compounds documented for Lepidium campestre across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Pregnane steroids5
Spirostane steroids4
Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids1
Documented compounds18 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Dioscin | present | NPASS | |
| (4aR)-3,4,4a,5,18,19-Hexahydro-9,21,22,26-tetramethoxy-4-methyl-2H-1,24:12,15-dietheno-6,10-metheno-16H-pyrido[2',3':17,18][1,10]dioxacycloeicosino[2,3,4-ij]isoquinoline | present | NPASS | |
| 1-[(3R,8R,9S,10R,13R,14R,16S,17S)-3-[(2S,3S,4R,5R,6S)-4-hydroxy-6-(hydroxymethyl)-3,5-bis[[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy]oxan-2-yl]oxy-16-methoxy-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-17-yl]ethanone | present | NPASS | |
| 1-[(3S,8R,9S,10R,13S,14S)-3-[(2R,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-4-[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-17-yl]ethanone | present | NPASS | |
| 1-[(3S,8R,9S,10R,13S,14S)-3-[(2R,3R,4S,5S,6R)-4-hydroxy-6-(hydroxymethyl)-3,5-bis[[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy]oxan-2-yl]oxy-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-17-yl]-2-methoxyethanone | present | NPASS | |
| 1-[(3S,8S,9S,10R,13S,14S,16R,17R)-3-[(2R,3R,4S,5S,6R)-4-hydroxy-6-(hydroxymethyl)-3,5-bis[[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy]oxan-2-yl]oxy-16-methoxy-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-17-yl]ethanone | present | NPASS | |
| BHGJAYRDOPBBLT-TZHBTPGTSA-N | present | NPASS | |
| CIBAPVLFORANSS-OBOJVYGLSA-N | present | NPASS | |
| Diosgenin | present | NPASS | |
| Gracillin | present | NPASS |
05DNA & barcoding36 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lepidium campestre has left across the world's sequence archives.
At a glance
DNA specimens36
Marker genes8
GenBank sequences10
eDNA detections15
Countries7
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACAAATC …
Lepidium campestre voucher CCDB-18326-C12 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★ITS4★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Lepidium campestre carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size224 940 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
THIS GENOME Lepidium campestre0.22 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records16–162n range16median16mode38records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1638×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +13
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · brit-fl — Montgomery, L., Khalaf, M.K., Bailey, J.P., Gornall, R.J. Watsonia 21: 365-368 (1997)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2359
CCDB · fl-europaea — LOve & LOve, 1956
CCDB · poland — Pogan E., Rychlewski J. et al. 1980 a. Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov. Ser. Bot. 22, 129-153.
CCDB · ipcn-api-dl — Ančev, M. E. 1983. Karyology and reproductive characteristics of some weedy and ruderal Cruciferae species in Bulgaria. In: Third National Botanical Conference, Sofia, 26-30. 10(1981): 232–233.
CCDB · ipcn-api-dl — Montgomery, L., M. Khalaf, J. P. Bailey & K. J. Gornal. 1997. Contributions to a cytological catalogue of the British and Irish flora, 5. Watsonia 21: 365–368.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Pogan, E. 1980. Further studies in chromosome numbers of Polish Angiosperms. Acta Biol. Cracov., Ser. Bot. 22: 129–153.
CCDB · ipcn-api-dl — Ančev, M. E. 1981. In Chromosome number reports LXXIII. Taxon 30:855.
CCDB · ipcn-api-dl — Javurkova, V. 1980. In Chromosome number reports LXIX. Taxon 29: 713–714.
CCDB · book-northern-plants — Wulff 1939 b.
CCDB · eflora
CCDB · book-fedorov — Wulff 1939b
CCDB · book-fedorov — Love A., Love D. 1936h
CCDB · book-fedorov — Mulligan 1957, 1961b
CCDB · book-fedorov — Easterly 1963
CCDB · brass — Dobes et al.
CCDB · brass — Ancev
CCDB · brass — Mulligan
CCDB · brass — Mjovsky et al.
CCDB · brass — Javurkov
CCDB · brass — Wulff
CCDB · brass — Lve & Lve
CCDB · brass — Pogan et al.
CCDB · brass — Montgomery et al.
CCDB · book-atlas-flowering-plants — Wulff 1939b
CCDB · Cave1956 — Love & Love b
CCDB · Cave1957 — Mulligan
CCDB · CromoCat 2015 — Ancev, M. E. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 855.
CCDB · CromoCat 2015 — Ancev, M. E. (1983a). Karyology and reproductive characteristics of some weedy and ruderal Cruciferae species in Bulgaria. Bulg. Acad. Sci., Sofia : 232-239.
CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.
CCDB · CromoCat 2015 — Javurková, V. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 713-714.
n 811×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +3
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Hill, L. M. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn75-78 — Hill 1978
CCDB · brass — Taylor & Mulligan
CCDB · brass — Javurkov-Jarolimov
CCDB · brass — Easterly
CCDB · brass — Hill
CCDB · Cave1963 — Easterly 1963
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Hill, L. M. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 522.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
Completeness44.9% BUSCO
08Occurrence & distribution
Record type43 818 records
Wild obs. + sensor37 922
Museum / vouchered5 417
Cultivated / captive12
Other467
Origin
Native79
Introduced2 299
Range
Area of Occupancy AOO87 164 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy41% within 1 km
≤100 m 9 326≤1 km 3 531≤10 km 17 874>10 km 501
31 232 georeferenced · 6 690 without coordinates
Open the mapobservation + sensor37 922
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 551≤1 km 1 075≤10 km 1 163>10 km 378
3 167 georeferenced · 2 250 without coordinates
Open the institutions mapphysical evidence5 417
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 11
12 georeferenced
Open the mapnot free-living12
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions141 of 211 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| LDlocation not on record | 353 |
| Philadelphia, US | 334 |
| BFLlocation not on record | 287 |
| Chongqing Museumlocation not on record | 280 |
| MeiseBGlocation not on record | 256 |
| BIO-UNIPIlocation not on record | 223 |
| SLU Artdatabankenlocation not on record | 209 |
| Olocation not on record | 183 |
| Helsinki, FI | 170 |
| DAOlocation not on record | 148 |
| Uppsala, SE | 147 |
| Zürich, CH | 146 |
| DBF-NHMDlocation not on record | 131 |
| Madison, US | 102 |
| Wuzhou, CN | 99 |
| Oskarshamn, SE | 97 |
| Moscow State Universitylocation not on record | 96 |
| College Park, US | 67 |
| Bloomington, US | 66 |
| Bergen, NO | 54 |
| Zürich, CH | 54 |
| University of Stellenboschlocation not on record | 51 |
| Turku, FI | 49 |
| Saint Louis, US | 46 |
| New Haven, US | 43 |
| Williamsburg, US | 42 |
| Hobart, AU | 42 |
| Burlington, US | 40 |
| Denver, US | 38 |
| Corvallis, US | 37 |
| KMNlocation not on record | 35 |
| Provincia di Livornolocation not on record | 33 |
| Moscow, US | 32 |
| Allentown, US | 32 |
| Acadia Universitylocation not on record | 31 |
| Oulu, FI | 30 |
| Toronto, CA | 30 |
| University of New Hampshirelocation not on record | 29 |
| Christchurch, NZ | 27 |
| Pullman, US | 26 |
| Mlocation not on record | 25 |
| Vancouver, CA | 25 |
| Arcata, US | 25 |
| Canadian Department of Agriculturelocation not on record | 24 |
| Boise, US | 24 |
| Riverside, US | 22 |
| Caldwell, US | 21 |
| Trondheim, NO | 21 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 21 |
| Logan, US | 21 |
| Mount Annan, AU | 20 |
| Bangkok, TH | 19 |
| Missoula, US | 17 |
| Claremont, US | 17 |
| Museo Entomologico de Leonlocation not on record | 16 |
| Canberra, AU | 16 |
| Pittsburg, US | 15 |
| McWane Science Centerlocation not on record | 15 |
| Bozeman, US | 14 |
| Tampa, US | 13 |
| Davis, US | 13 |
| Pocatello, US | 13 |
| Chapel Hill, US | 13 |
| Flagstaff, US | 12 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 12 |
| Staten Island, US | 12 |
| Lord Fairfax Community Collegelocation not on record | 12 |
| Knoxville, US | 11 |
| Provo, US | 11 |
| NMBU:MINAlocation not on record | 11 |
| CASlocation not on record | 10 |
| Armidale, AU | 10 |
| San Diego, US | 10 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 10 |
| Green Bay, US | 9 |
| Emporia, US | 9 |
| Washington, US | 9 |
| TROMlocation not on record | 9 |
| Chadron, US | 9 |
| Saint John, CA | 8 |
| Millersville, US | 8 |
| Whitewater, US | 8 |
| Mohonk Preservelocation not on record | 7 |
| BClocation not on record | 7 |
| Little Rock, US | 7 |
| St. Paul, US | 7 |
| Montréal, CA | 7 |
| Morgantown, US | 7 |
| Norfolk, US | 7 |
| BAYLUlocation not on record | 6 |
| LfUlocation not on record | 6 |
| IDElocation not on record | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 6 |
| TUR-Alocation not on record | 6 |
| Chicago, US | 6 |
| Columbia, US | 6 |
| Dekalb, US | 6 |
| Philadelphia, US | 6 |
| QVMAGlocation not on record | 5 |
| San Francisco, US | 5 |
| Fayetteville, US | 5 |
| Durango, US | 5 |
| ASUlocation not on record | 5 |
| Oswego, US | 5 |
| Dover, US | 5 |
| DOI/NPS, Greenbelt Parklocation not on record | 5 |
| Tallinn, EE | 5 |
| Brisbane, AU | 5 |
| Richmond, US | 4 |
| Springfield, US | 4 |
| Johnson City, US | 4 |
| Monastir, TN | 4 |
| Keene State Universitylocation not on record | 4 |
| Tacoma, US | 4 |
| Fairfax, US | 4 |
| Whitehorse, CA | 4 |
| Beijing, CN | 4 |
| Cheney, US | 3 |
| Winterthur, CH | 3 |
| Clemson, US | 3 |
| Davenport, US | 3 |
| National Museum Waleslocation not on record | 3 |
| Orem, US | 3 |
| Eastern Nevada Landscape Coalitionlocation not on record | 3 |
| Sion, CH | 3 |
| KNFYlocation not on record | 3 |
| H-Schuhwlocation not on record | 3 |
| Philadelphia, US | 3 |
| Anchorage, US | 3 |
| Göteborg, SE | 3 |
| Santa Barbara, US | 3 |
| Kirksville, US | 3 |
| BSBIlocation not on record | 3 |
| Phoenix, US | 3 |
| San Luis Obispo, US | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Adelaide, AU | 2 |
| Northridge, US | 2 |
| Kingston, US | 2 |
| Tartu, EE | 2 |
| Mount Pleasant, US | 2 |
| EL PASO, US | 2 |
| Los Angeles, US | 2 |
| Mississippi State, US | 2 |
| Berlin, DE | 2 |
| Kuopio, FI | 2 |
| PrivatHerblocation not on record | 2 |
| Hudson, US | 2 |
| New Brunswick, US | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| University of Alberta Museumslocation not on record | 2 |
| Musée des Confluenceslocation not on record | 2 |
| US | 2 |
| Lincoln, US | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Meguro Parasitological Museumlocation not on record | 2 |
| H-Adlerlocation not on record | 2 |
| Jefferson City, US | 2 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 2 |
| Harrisonburg, US | 2 |
| Kew, GB | 2 |
| Porvoo, FI | 1 |
| H-AkrKGlocation not on record | 1 |
| No collectionlocation not on record | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| Podgorica, ME | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Tuscaloosa, US | 1 |
| Chicago, US | 1 |
| Ivano-Frankove, UA | 1 |
| Salamanca, ES | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Cambridge, US | 1 |
| H-HarzKurtlocation not on record | 1 |
| München, DE | 1 |
| SEFlocation not on record | 1 |
| Macomb, US | 1 |
| Parkville, AU | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Hamilton, US | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Jyväskylä, FI | 1 |
| Henderson, US | 1 |
| POL003location not on record | 1 |
| Chicago, US | 1 |
| Spearfish, US | 1 |
| GAlocation not on record | 1 |
| Asheville, US | 1 |
| Jurica-Suchy Nature Museumlocation not on record | 1 |
| Turlock, US | 1 |
| San Angelo, US | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Irvine, US | 1 |
| US | 1 |
| Fullerton, US | 1 |
| KNFHClocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Brookings, US | 1 |
| Bothell, US | 1 |
| Conway, US | 1 |
| Miami, US | 1 |
| València, ES | 1 |
| Long Beach, US | 1 |
| Durham, US | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Pamplona, ES | 1 |
| University of Southern Mississippilocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Salvador, BR | 1 |
| San Jose, US | 1 |
| Regensburgische Botanische Gesellschaftlocation not on record | 1 |
211 institutions · 5 159 of 5 417 vouchered records shown · 247 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA15 detections
Where the DNA of Lepidium campestre was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found15
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 15 detections have coordinates
Open the map5 countries0
next to pathOpen space around oaks.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.1 °C 10.4–18.1
Seasonal swing summer↔winter14.0 °C
Max temp (day)15.8 °C 13.1–24.0
Min temp (night)8.30 °C 7.20–13.6
Precipitation80.3 mm/mo 33.9–94.0
Air humidity62.1 % 54.9–63.6
Moisture balance-35.4 mm/mo -92.9–-9.20
Vapour deficit573 Pa 479–906
Wind speed3.90 m/s 2.40–5.20
Cloud cover41.9 % 38.6–48.0
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.