Lepidium austrinum

Small · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Lepidium

At a glance

Occurrence records830

Data sources8

Biological traits10

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Lepidium austrinum's data was compiled from.

GBIFGlobal Biodiversity Information Facility830 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF830 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 32

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual or biennial

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lepidium austrinum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAJ582467.1 ↗267 bpUSA

ACGT

TCGATACCTGTCCAAAACAGAACGACCCGCGAACCAACTATCATCACTTGCGGTGGGCCGGTTTCCTAGCAGATCCCGTGTCCTCCGAAT …

Lepidium austrinum internal transcribed spacer 1 (ITS1), specimen voucher Davis 17451

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Lepidium austrinum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 162×CCDB · ipcn-api-dl · CCDB · brass

CCDB · ipcn-api-dl — Rollins, R. C. & L. RUDENBERG. 1977. Chromosome numbers of Cruciferae III. Contr. Gray Herb. 207: 101–116.

CCDB · brass — Rollins & Rdenberg

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type830 records

Wild obs. + sensor434

Museum / vouchered393

Other3

Range

Area of Occupancy AOO2 356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 274≤1 km 36≤10 km 9>10 km 25

344 georeferenced · 90 without coordinates

Open the mapobservation + sensor434

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 31≤1 km 51≤10 km 115>10 km 27

224 georeferenced · 169 without coordinates

Open the institutions mapphysical evidence393

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	131
Fort Worth, US	79
Texas Lutheran Universitylocation not on record	25
BAYLUlocation not on record	23
Bronx, US	23
Wuzhou, CN	17
Lubbock, US	14
Saint Louis, US	13
Riverside, US	6
San Angelo, US	6
Mexico City, MX	6
LDlocation not on record	6
Denton, US	5
EL PASO, US	4
Jackson, US	4
Chapel Hill, US	3
Stephenville, US	2
Jena Microbial Resource Collectionlocation not on record	2
Austin, US	2
Chicago, US	1
Davis, US	1
Tampa, US	1
James F. Matthews Center for Biodiversity Studieslocation not on record	1
Zürich, CH	1
Canadian Department of Agriculturelocation not on record	1
Chongqing Museumlocation not on record	1
GB	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Pullman, US	1
Albuquerque, US	1

30 institutions · 382 of 393 vouchered records shown · 10 without an institution code

09Environmental DNA1 detections

Where the DNA of Lepidium austrinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)