Lepidium africanum

(Burm.f.) DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Lepidium

At a glance

Occurrence records11 719

Data sources11

Biological traits51

DNA specimens2

eDNA detections3

Sources11 archives

Databases and archives Lepidium africanum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 719 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources51 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF11 719 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT · NCBI≈225 Mbp

01Narrative

Lepidium africanum — вид рослин з роду хріниця (Lepidium) родини капустяних (Brassicaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology24

Fruit length3 mm

Fruit width2 mm

Leaf length40 mm

Leaf length max60 mm

Leaf length min15 mm

Leaf mass4 mg

Leaf mass per area84.03 g/m2

Leaf size78.54 mm²

Leaf width2.4 mm

⚠ sources differ — AusTraits: 2.4 mm · GIFT: 8 mm

Leaf width max8.75 mm

Leaf width min8 mm

Plant height0.5 m

⚠ sources differ — GIFT: 0.5 m · AusTraits: 0.5 m · TRY: 0.3 m

Plant height max0.75 m

Plant height min0.1 m

Seed length1.46 mm

Seed length max1.4 mm

Seed length min1.4 mm

Seed mass0.31 mg

⚠ sources differ — TRY: 0.31 mg · AusTraits: 0.27 mg · GIFT: 0.3 mg

Seed mass max0.34 mg

Seed mass min0.26 mg

Seed volume1.8 mm³

Seed volume max1.8 mm³

Seed volume min1.8 mm³

Seed width0.64 mm

Life cycle & reproduction10

Dispersal typeself

Flowering timeyynnnnnnnnny

Life formannual or perennial

Life spanperennial

Lifespan years17 years

⚠ sources differ — TRY: 17 years · AusTraits: 9.5 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 700 m

Elevation min50 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typesilique

Growth formherb

Habitat GIFTCoastal

Leaf compoundnesssimple

Leaf shapelanceolate linear

Woodinessnon-woody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)11.92 mm²/mg

03Chemical composition2 compounds

Compounds documented for Lepidium africanum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Glucosinolates2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (1Z)-2-phenyl-N-sulfooxyethanimidothioate		present	LOTUS
Glucotropaeolin		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lepidium africanum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences4

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAJ582441.1 ↗267 bpSouth Africa

ACGT

TCGATACCTGTCCAAAACAGAACGACCCGCGAACCAACTATCATCACTTGCGGTGGGCCGGTTTCTTAGCTGATCCCGTGCCCGCCGAAT …

Lepidium africanum internal transcribed spacer 1 (ITS1), specimen voucher 687

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Lepidium africanum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈225 262 187 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Lepidium africanum0.23 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–322n range16median16mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 166×CCDB · nw-europe-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2364

CCDB · ipcn-api-dl — Polatschek, A. 1983. Chromosomenzahlen und hinweise auf systematik und verbreitung van Brassicaceae-Arten aus Europa, Nordafrika, Asien und Australien. Phyton (Horn). 23: 127–139.

CCDB · ipcn-api-dl — Jonsell, B. 1975. Lepidium L. (Cruciferae) in tropical Africa. A morphological, taxonomical and phytogeographical study. Bot. Not. 128: 20–46.

CCDB · book-ipcn75-78 — Jonsell 1975

CCDB · brass — Polatschek

CCDB · brass — Jonsell

2n 322×CCDB · ipcn-api-dl · CCDB · brass

CCDB · ipcn-api-dl — Johnson, M. A. T. 1993. In B. Mathew, Sternbergia pulchella. Garden (London 1975+) 118(1): 36–37.

CCDB · brass — Hurka et al.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness95.5% BUSCO

08Occurrence & distribution

Record type11 719 records

Wild obs. + sensor9 072

Museum / vouchered1 813

Cultivated / captive1

Other833

Origin

Native5

Introduced9 224

Range

Area of Occupancy AOO28 096 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 6 690≤1 km 1 851≤10 km 324>10 km 19

8 884 georeferenced · 188 without coordinates

Open the mapobservation + sensor9 072

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 498≤1 km 284≤10 km 555>10 km 49

1 386 georeferenced · 427 without coordinates

Open the institutions mapphysical evidence1 813

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	300
Museo Entomologico de Leonlocation not on record	256
Canberra, AU	197
NSW Dept of Planning, Industry and Environmentlocation not on record	187
Mount Annan, AU	170
Brisbane, AU	114
Christchurch, NZ	113
Kensington, AU	65
NSW Office of Environment and Heritagelocation not on record	55
Auckland, NZ	50
Hobart, AU	41
Armidale, AU	24
Bern, CH	19
Wellington, NZ	18
Palmerston, AU	13
Zürich, CH	13
Rotorua, NZ	12
Odawara, JP	10
Cape Town, ZA	8
Zürich, CH	6
John T. Waterhouse Herbariumlocation not on record	5
BISHlocation not on record	5
Saint Louis, US	5
Chapel Hill, US	5
Canadian Department of Agriculturelocation not on record	5
Honolulu, US	5
Kew, GB	5
BGPAlocation not on record	4
MeiseBGlocation not on record	3
University of Stellenboschlocation not on record	3
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	2
Wollongong, AU	2
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	2
Instituto de Investigação Científica Tropicallocation not on record	2
Plocation not on record	1
Boise, US	1
Stockholm, SE	1
Wlocation not on record	1
Sanda, JP	1
MAlocation not on record	1
Durban, ZA	1
Bronx, US	1
Parkville, AU	1
JP	1
QVMAGlocation not on record	1

45 institutions · 1 735 of 1 813 vouchered records shown · 77 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Lepidium africanum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.3 °C 19.1–21.6

Seasonal swing summer↔winter17.0 °C

Max temp (day)27.5 °C 26.8–28.3

Min temp (night)13.3 °C 12.0–14.7

Precipitation25.0 mm/mo 17.5–32.6

Air humidity45.8 % 43.9–47.8

Moisture balance-121 mm/mo -138–-103

Vapour deficit1,405 Pa 1,230–1,580

Wind speed3.50 m/s 3.00–3.90

Cloud cover17.2 % 16.4–17.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Lepidium africanum

At a glance

Sources11 archives

Size & morphology24

Life cycle & reproduction10

Diet & foraging1

Habitat & environment13

Physiology & chemistry3

Compound class profile1 class

Documented compounds2 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type11 719 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions29 of 45 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type11 719 records