Lepidagathis keralensis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Lepidagathis

At a glance

Occurrence records12

Data sources4

Biological traits2

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Lepidagathis keralensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility12 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources2 traits

Occurrence & distributionGBIF12 records

DNA & barcodingNCBIsequences

01Narrative

Lepidagathis keralensis is a plant species described by PV Madhusoodanan and NP Singh. Lepidagathis keralensis is included in the genus Lepidagathis and the family Acanthaceae. No subspecies are listed in the Catalog of Life.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Habitat & environment1

Climatewet tropical

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lepidagathis keralensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ024148.1 ↗709 bpIndia · 2023

ACGT

TAGGTGAACCTGCGGAAGGATCATTGTCGAACCTAAAACGAGCAGACCGCGAACCCGTTCCACAACACGTGGGCGGCCGCTGCGCAGGAG …

Lepidagathis keralensis voucher UH:1021 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type12 records

Wild obs. + sensor12

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤1 km 1≤10 km 4>10 km 2

7 georeferenced · 5 without coordinates

Open the mapobservation + sensor12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.