Lepidagathis cuspidata

Nees · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Lepidagathis

At a glance

Occurrence records69

Data sources10

Biological traits3

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Lepidagathis cuspidata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility69 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF69 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Lepidagathis cuspidata (also known as Kodajathripaccha, Kodassathripaccha and Spiny Lepidagathis) is a species of plant in the family Acanthaceae. It is native to India and is a prickly subshrub growing profusely on hilly terrain in the Western Ghats, in evergreen forests and in wet places. It has been recorded in the Indian states of Assam, Gujarat, Maharashtra, Karnataka, Kerala and Tamil Nadu, as well as in Nepal and Pakistan.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Life cycle & reproduction1

Life formsubshrub

Habitat & environment1

Climateseasonally dry tropical

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lepidagathis cuspidata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJF346167.1 ↗708 bp

ACGT

TCGTAGGTTCCAAGCGGAAGGATCACTGTCGAAACCTGCACAGCAGACCGTGAACACGTGTATTTAACTTCACGGGGGCCGCGGCGTGTG …

Lepidagathis cuspidata internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Lepidagathis cuspidata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Verma, S.C. & Dhillon, S.S. 1967 ; Sareen, T.S. & Sanjogta, K. 1976

n 116×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · iapt — IAPT/IOPB Chromosome Data 12

CCDB · ipcn-api-dl — Saggoo, M. I. 1983. Cytomorphological studies on plants of economic importance of Bicarpellatae from India. 259 pp.

CCDB · ipcn-api-dl — Bir, S. S. & M. I. S. Saggoo. 1981. Cytopalynology of certain Acanthaceae and Labiatae. J. Palynol. 17: 93–102.

CCDB · ipcn-api-dl — Sareen, T. S. & K. SANJOTA. 1976. Chromosome numbers in some species of Acanthaceae. Cytologia 41: 283–290.

CCDB · ipcn-api-dl — VASUDEVAN, K. N. 1976. Contribution to the cytotaxonomy and cytogeography of the flora of the western Himalayas (with an attempt to compare it with the flora of the Alps). Part III. Ber. Schweiz. Bot. Ges. 86: 152–203.

CCDB · book-ipcn67-71 — VERMA, S. C., & S. S. DHILLON. 1967. In IOPB chromosome number reports XI. Taxon 16: 215-222.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.224 ↗

08Occurrence & distribution

Record type69 records

Wild obs. + sensor33

Museum / vouchered36

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 7≤1 km 6≤10 km 5>10 km 1

19 georeferenced · 14 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤1 km 17≤10 km 9>10 km 4

30 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Baroda, IN	20
Berlin, DE	2
Dehra Dun, IN	2
NGCPR00901location not on record	1
NGCPR00899location not on record	1
NGCPR01046location not on record	1
NGCPR00903location not on record	1
Tampa, US	1
NGCPR00902location not on record	1
Natural History Museum, Tribhuvan Universitylocation not on record	1
NGCPR00900location not on record	1
NGCPR00897location not on record	1
NGCPR00898location not on record	1
NGCPR01045location not on record	1

14 institutions · 35 of 36 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Lepidagathis cuspidata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)