Lepechinia calycina

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Lepechinia

At a glance

Occurrence records4 260

Data sources12

Biological traits20

DNA specimens4

eDNA detections4

Sources12 archives

Databases and archives Lepechinia calycina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 260 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF4 260 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 32

01Narrative

Lepechinia calycina là một loài thực vật có hoa trong họ Hoa môi. Loài này được (Benth.) Epling mô tả khoa học đầu tiên năm 1935.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height2.9 m

Seed mass14.31 mg

Seed mass max21.16 mg

Seed mass min7.82 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry5

Leaf n19.26 mg/g

Leaf p1.2 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)10.45 mm²/mg

Wood density610 mg/cm³

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lepechinia calycina has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences4

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSDQ667308.1 ↗618 bp

ACGT

TGCGGAAAGGATCATTGTCGGGACCTGCACAGCAGACCGCGAACACGTTGCTTAACGCCGCGGCGCACGGCGCGGGGGCGAGCCCCCCGT …

Lepechinia calycina isolate x246 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Lepechinia calycina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidydiploid inferred

Chromosome records32–322n range32median32mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 322×GoaT · Tree of Sex Database · TreeOfSex · plant

GoaT · Tree of Sex Database — ↗

TreeOfSex · plant — perscomm-Drew ↗

n 161×CCDB · Cave1958

CCDB · Cave1958 — Epling 1948

n 171×CCDB · book-ipcn65

CCDB · book-ipcn65 — Raven et al. 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 260 records

Wild obs. + sensor3 795

Museum / vouchered465

Range

Area of Occupancy AOO2 908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 2 330≤1 km 343≤10 km 172>10 km 56

2 901 georeferenced · 894 without coordinates

Open the mapobservation + sensor3 795

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 18≤1 km 148≤10 km 144>10 km 1

311 georeferenced · 154 without coordinates

Open the institutions mapphysical evidence465

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	75
Santa Barbara, US	64
San Luis Obispo, US	31
US	28
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	24
CASlocation not on record	17
Riverside, US	16
San Diego, US	13
Canadian Department of Agriculturelocation not on record	12
Arcata, US	11
Los Angeles, US	9
Angwin, US	7
San Francisco, US	7
San Jose, US	6
University of Stellenboschlocation not on record	6
Santa Cruz, US	5
EL PASO, US	4
Northridge, US	4
Bronx, US	2
Columbia, US	2
Davis, US	2
Wuzhou, CN	2
Bloomington, US	2
Severin-McDaniel Insect Collectionlocation not on record	2
South Kensington, GB	2
Kew, GB	1
Chongqing Museumlocation not on record	1
Irvine, US	1
Saint Louis, US	1
Long Beach, US	1
MeiseBGlocation not on record	1
Wellington, NZ	1
Corvallis, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Oskarshamn, SE	1
Ashland, US	1
ASUlocation not on record	1
Madison, US	1
Bangkok, TH	1

39 institutions · 367 of 465 vouchered records shown · 98 without an institution code

09Environmental DNA4 detections

Where the DNA of Lepechinia calycina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources12 archives

Size & morphology4

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

Physiology & chemistry5

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 260 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions30 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type4 260 records