Lepanthes lucifer — The Life Data

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Lepanthes

At a glance

Occurrence records1

Data sources5

Biological traits7

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Lepanthes lucifer's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF1 records

DNA & barcodingNCBIsequences

01Narrative

Lepanthes lucifer is a species of orchid endemic to Ecuador.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formepiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formepiphyte

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lepanthes lucifer has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ470322.1 ↗587 bpEcuador · 2023

ACGT

TGCGCGGCGGCACCAGCCGCCGCAAACAGTCGTCCTGGATTGTTGGCCGCGTCACCTGTCGGGGCCGCGATGAGGGGCGATTGAAACTCA …

Lepanthes lucifer voucher LB-3148 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type1 records

Museum / vouchered1

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	1

1 institutions · 1 of 1 vouchered records shown