Leonurus sibiricus
speciesAt a glance
Occurrence records2 149
Data sources13
Biological traits24
DNA specimens11
eDNA detections10
Sources13 archives
Databases and archives Leonurus sibiricus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility2 149 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics11 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources24 traits
Chemical compositionLOTUS · NPASS70 compounds
Occurrence & distributionGBIF2 149 records
Environmental DNA1 datasets · 1 countries10 detections
DNA & barcodingBOLD · NCBI11 specimens
Genome at a glanceCCDB2n = 20
01Narrative
Leonurus sibiricus, communément appelée Marijuanilla ou Agripaume de Sibérie, est une espèce de plantes à fleurs de la famille des Lamiaceae. C'est une plante herbacée provenant d'Asie, à l'origine au sud de la Sibérie, Japon, Chine, Viêt Nam. De nos jours, elle est également cultivée dans la région du Chiapas (Mexique) et au Brésil.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology5
Plant height max1.5 m
Plant height min0.3 m
Seed mass1.2 mg
Seed mass max1.2 mg
Seed mass min1.2 mg
Life cycle & reproduction6
Flowering endSep
Flowering startJun
Life formannual or biennial
Life spanannual
Raunkiær life formtherophyte
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 250 m
Elevation min700 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTforest, mountains, steppe, stony places
Woodinessnon-woody
Physiology & chemistry3
Leaf n22.76 mg/g
Leaf p2.3 mg/g
Photosynthetic pathwayC3
03Chemical composition70 compounds
Compounds documented for Leonurus sibiricus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Labdane diterpenoids29
Gallotannins10
Podocarpane diterpenoids8
Secolabdane diterpenoids4
Abeoabietane diterpenoids2
Documented compounds70 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,4S,8S,9S,10R)-9-[2-(furan-3-yl)ethyl]-9,10-dihydroxy-10-(hydroxymethyl)-4,8-dimethyl-2-oxatricyclo[6.3.1.04,12]dodecan-3-one | present | LOTUS | |
| (1R,4S,8S,9S,10R,12R)-9-[2-(furan-3-yl)ethyl]-9,10-dihydroxy-10-(hydroxymethyl)-4,8-dimethyl-2-oxatricyclo[6.3.1.04,12]dodecan-3-one | present | LOTUS | |
| (1R,4S,8S,9S,10S)-9-[2-(furan-3-yl)ethyl]-9,10-dihydroxy-4,8,10-trimethyl-2-oxatricyclo[6.3.1.04,12]dodecan-3-one | present | LOTUS | |
| (1R,4S,8S,9S,10S,12R)-9-[2-(furan-3-yl)ethyl]-9,10-dihydroxy-4,8,10-trimethyl-2-oxatricyclo[6.3.1.04,12]dodecan-3-one | present | LOTUS | |
| (2R)-4-[2-[(1R,2S,4S,4aS,8aS)-1,4-dihydroxy-2,5,5,8a-tetramethyl-3-oxo-2,4,4a,6,7,8-hexahydronaphthalen-1-yl]ethyl]-2-methoxy-2H-furan-5-one | present | LOTUS | |
| (2S)-3-[2-[(1R,2R,3R,4aS,8aS)-1,3-dihydroxy-2,5,5,8a-tetramethyl-4-oxo-2,3,4a,6,7,8-hexahydronaphthalen-1-yl]ethyl]-2-hydroxy-2H-furan-5-one | present | LOTUS | |
| (2S)-3-[2-[(4S,4aR,8aS)-4-hydroxy-2,5,5,8a-tetramethyl-3-oxo-4a,6,7,8-tetrahydro-4H-naphthalen-1-yl]ethyl]-2-hydroxy-2H-furan-5-one | present | LOTUS | |
| (2S)-3-[2-[(4S,4aS,8aS)-4-hydroxy-2,5,5,8a-tetramethyl-3-oxo-4a,6,7,8-tetrahydro-4H-naphthalen-1-yl]ethyl]-2-hydroxy-2H-furan-5-one | present | LOTUS | |
| (2S)-4-[2-[(1R,2S,4S,4aS,8aS)-1,4-dihydroxy-2,5,5,8a-tetramethyl-3-oxo-2,4,4a,6,7,8-hexahydronaphthalen-1-yl]ethyl]-2-methoxy-2H-furan-5-one | present | LOTUS | |
| (3S,4aR,6aS,6bR,8aR,11R,12S,12aR,14bS)-4,4,6a,6b,8a,11,12,14b-octamethyl-2,3,4a,5,6,7,8,9,10,11,12,12a-dodecahydro-1H-picen-3-ol | present | NPASS |
05DNA & barcoding11 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Leonurus sibiricus has left across the world's sequence archives.
At a glance
DNA specimens11
Marker genes5
GenBank sequences10
eDNA detections10
Countries2
The DNA barcodea real sequence read deposited for this species
CGCATCGCGTCGCCCCCCTCCCCCGCGGGGTGGGGCGGAGATTGGCCTCCCGTGCGCGATCGCGCGCGCGGCCGGCCCAAATGCGAATCC …
Paraleonurus sibiricus voucher JP022MT01 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL4★rbcLa★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Leonurus sibiricus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidydiploid inferred
Chromosome records18–202n range20median20mode10records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 208×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-indian_vol1 +2
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · ipcn-api-dl — Zhang, Y. x. 1994. Studies on chromosomes of some plants from Guandi Mountain, Shanxi. J. Wuhan Bot. Res. 12(2): 201–206.
CCDB · book-indian_vol1 — Suzuka, O. 1950a (D. 1955) ; Chuang, T .I. et al. 1963; Pal, S. 1971 ; Sarkar, A.K. et al. 1973a
CCDB · book-fedorov — Suzuka 1950a
CCDB · book-fedorov — D. 1955)
CCDB · book-fedorov — Chuang et al. 1963
CCDB · book-fedorov — I. 1963)
CCDB · book-atlas-flowering-plants — Suzuka 1950a
2n 182×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Krestovskaja, T. 1988. Chromosome numbers in some species of the genus Leonurus (Lamiaceae). Bot. Žhurn. (Moscow & Leningrad) 73: 289.
n 104×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74 +1
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn75-78 — Sharma 1970
CCDB · book-ipcn73-74 — SARKAR, A.K., N. DATTA., & U. CHATTERJEE. 1973. In IOPB chromosome number reports XLII. Taxon 22: 647-654.
CCDB · Cave1963 — Chuang et al. 1963
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type2 149 records
Wild obs. + sensor344
Museum / vouchered1 800
Cultivated / captive4
Other1
Origin
Native4
Introduced54
Range
Area of Occupancy AOO4 736 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy57% within 1 km
≤100 m 83≤1 km 81≤10 km 45>10 km 77
286 georeferenced · 58 without coordinates
Open the mapobservation + sensor344
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy76% within 1 km
≤100 m 154≤1 km 23≤10 km 38>10 km 17
232 georeferenced · 1 568 without coordinates
Open the institutions mapphysical evidence1 800
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 4
4 georeferenced
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions103 of 211 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 206 |
| Durango, MX | 135 |
| Taipei, TW | 82 |
| Guangzhou, CN | 80 |
| Bronx, US | 79 |
| Nanjing, CN | 68 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 60 |
| Yangling, CN | 46 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 41 |
| PUC-RSlocation not on record | 36 |
| Chicago, US | 33 |
| FJIDClocation not on record | 32 |
| Castelar, AR | 30 |
| San Isidro, AR | 29 |
| Wuhan, CN | 27 |
| Istituto Agrario Castelnuovolocation not on record | 26 |
| Xining, CN | 26 |
| Maringá, BR | 21 |
| Nanjing, CN | 21 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 18 |
| Wuhan, CN | 18 |
| Austin, US | 16 |
| Universidad Industrial de Santander (UIS)location not on record | 14 |
| Inner Mongolia Universitylocation not on record | 14 |
| WNNUlocation not on record | 12 |
| Shanxi Institute of Biologylocation not on record | 12 |
| UEMlocation not on record | 12 |
| IMMUlocation not on record | 12 |
| UNESClocation not on record | 11 |
| Guilin, CN | 11 |
| JBRJlocation not on record | 11 |
| Xian, CN | 11 |
| KIWElocation not on record | 10 |
| Mérida, MX | 10 |
| NSMKlocation not on record | 10 |
| Christchurch, NZ | 10 |
| Criciúma, BR | 9 |
| Jiangxi College of Educationlocation not on record | 9 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 9 |
| Tuxtla Gutiérrez, MX | 9 |
| Odawara, JP | 9 |
| Tianjin Natural History Museumlocation not on record | 8 |
| Uppsala, SE | 8 |
| INBIOlocation not on record | 8 |
| Kyoto Universitylocation not on record | 8 |
| Mexico City, MX | 8 |
| FUNEDlocation not on record | 8 |
| Wuzhou, CN | 8 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 7 |
| Lanzhou, CN | 7 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 6 |
| Williamsburg, US | 6 |
| UFRRJlocation not on record | 6 |
| Saint Louis, US | 6 |
| Taipei, TW | 6 |
| Fort Worth, US | 6 |
| Zhengzhou, CN | 6 |
| Guiyang, CN | 5 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 5 |
| Seoul, KR | 5 |
| Hangzhou, CN | 5 |
| Awka, NG | 5 |
| UFMSlocation not on record | 5 |
| Seropédica, BR | 5 |
| Xinxiang, CN | 5 |
| Blumenau, BR | 4 |
| Corrientes, AR | 4 |
| Uberlândia, BR | 4 |
| Zürich, CH | 4 |
| Chapingo, MX | 4 |
| Kew, GB | 4 |
| J. Rusek Collectionlocation not on record | 4 |
| UNICAMPlocation not on record | 4 |
| Xiamen, CN | 4 |
| Riverside, US | 4 |
| Beijing, CN | 4 |
| Museo Entomologico de Leonlocation not on record | 4 |
| Pelotas, BR | 3 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 3 |
| San Diego, US | 3 |
| Cascavel, BR | 3 |
| ENTClocation not on record | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| Glocation not on record | 3 |
| Yunnan Universitylocation not on record | 3 |
| Nagasaki University - Fisherieslocation not on record | 3 |
| San Francisco de Campeche, MX | 3 |
| Chongqing Museumlocation not on record | 3 |
| REALlocation not on record | 3 |
| Sucre, BO | 3 |
| St. Paul, US | 3 |
| ASUlocation not on record | 3 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 3 |
| Palmerston, AU | 3 |
| Central China Normal Universitylocation not on record | 3 |
| Northeastern Forestry Universitylocation not on record | 3 |
| Chongqing Natural History Museumlocation not on record | 3 |
| Guizhou Forestry Schoollocation not on record | 2 |
| Kunming, CN | 2 |
| Juriquilla, MX | 2 |
| UnBlocation not on record | 2 |
| UNESP-RClocation not on record | 2 |
| Beijing Natural History Museumlocation not on record | 2 |
| SLU Artdatabankenlocation not on record | 2 |
| Flagstaff, US | 2 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 2 |
| Mexico City, MX | 2 |
| Hobart, AU | 2 |
| Chengdu, CN | 2 |
| Honolulu, US | 2 |
| Dekalb, US | 2 |
| Córdoba, AR | 2 |
| CJBGlocation not on record | 2 |
| Université de Strasbourglocation not on record | 2 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 2 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 2 |
| Tapachula, MX | 2 |
| Montréal, CA | 2 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 2 |
| Peking Universitylocation not on record | 2 |
| INMAlocation not on record | 2 |
| HUENFlocation not on record | 2 |
| Shanxi Universitylocation not on record | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| Santa Teresa, BR | 2 |
| Shanghai, CN | 2 |
| Tall Timbers Research Stationlocation not on record | 1 |
| UNEMATlocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Cambridge University Herbariumlocation not on record | 1 |
| Millersville, US | 1 |
| Pullman, US | 1 |
| Altos de Pipe, VE | 1 |
| Fredericksburg, US | 1 |
| Foz do Iguaçu, BR | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 1 |
| Minia, EG | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Universidade Tecnológica Federal do Paranálocation not on record | 1 |
| Museo de Historia Natural, Universidad Ricardo Palmalocation not on record | 1 |
| Iquitos, PE | 1 |
| Lima, PE | 1 |
| Cambridge, US | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| SMMUlocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Badajoz, ES | 1 |
| ifplocation not on record | 1 |
| US | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| Universidad Nacional de Asunciónlocation not on record | 1 |
| UDESC-CAVlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| UFBAlocation not on record | 1 |
| South China Normal Universitylocation not on record | 1 |
| Shanghai, CN | 1 |
| Taiyuan Normal Universitylocation not on record | 1 |
| Mississippi State, US | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| Chengdu, CN | 1 |
| HUT Culture Collectionlocation not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Denver, US | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Miami, US | 1 |
| University of Stellenboschlocation not on record | 1 |
| UERJlocation not on record | 1 |
| Cambridge, US | 1 |
| Los Angeles, US | 1 |
| Universidad Nacional de Misiones- CONICETlocation not on record | 1 |
| Salta, AR | 1 |
| BAYLUlocation not on record | 1 |
| Lake Charles, US | 1 |
| BISHlocation not on record | 1 |
| TAIElocation not on record | 1 |
| Bangkok, TH | 1 |
| UNESP-IBILCElocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| Taipei, TW | 1 |
| Capital Normal Universitylocation not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| WTUlocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Burlington, US | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Mexico City, MX | 1 |
| LDlocation not on record | 1 |
| San Francisco, US | 1 |
| Austin, US | 1 |
| UFESlocation not on record | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| Chengdu, CN | 1 |
| CASlocation not on record | 1 |
| UFSClocation not on record | 1 |
| Guatemala City, GT | 1 |
| Guangzhou, CN | 1 |
| Smithfield, AU | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| South Kensington, GB | 1 |
| US | 1 |
| CEPLAClocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| UFVJMlocation not on record | 1 |
| Beijing Normal Universitylocation not on record | 1 |
211 institutions · 1 739 of 1 800 vouchered records shown · 61 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA10 detections
Where the DNA of Leonurus sibiricus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median21.1 °C 21.1–21.1
Seasonal swing summer↔winter9.50 °C
Max temp (day)26.2 °C
Min temp (night)17.2 °C
Precipitation1.50 mm/mo
Air humidity63.9 %
Moisture balance-160 mm/mo
Vapour deficit901 Pa
Wind speed1.50 m/s
Cloud cover12.2 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.