Leonurus cardiaca
speciesAt a glance
Occurrence records65 640
Data sources15
Biological traits45
DNA specimens37
eDNA detections20
Sources15 archives
Databases and archives Leonurus cardiaca's data was compiled from.
WikipediaWikimedia Foundation13 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility65 640 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics37 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources45 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS86 compounds
Occurrence & distributionGBIF65 640 records
Environmental DNA1 datasets · 6 countries20 detections
DNA & barcodingBOLD · NCBI37 specimens
Genome at a glanceCCDB834 Mbp
01Narrative
Leonurus cardiaca, known as motherwort, is an herbaceous perennial plant in the mint family, Lamiaceae. Other common names include throw-wort, lion's ear, and lion's tail. Lion's tail is also a common name for Leonotis leonurus, and lion's ear, a common name for Leonotis nepetifolia. Originally from Central Asia and southeastern Europe, it is now found worldwide, spread largely due to its use as a herbal remedy.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology16
Fruit length2 mm
Leaf length75 mm
Leaf length max280 mm
Leaf length min30 mm
Leaf size1 674 mm²
Leaf width30 mm
⚠ sources differ — AusTraits: 30 mm · GIFT: 80 mm
Leaf width max40 mm
Leaf width min20 mm
Plant height0.65 m
⚠ sources differ — GIFT: 0.65 m · AusTraits: 1.15 m · LEDA: 0.65 m · TRY: 0.883 m
Plant height generative0.65 m
Plant height max2 m
Plant height min0.3 m
Seed length2.5 mm
Seed mass0.941 mg
⚠ sources differ — TRY: 0.941 mg · LEDA: 0.885 mg · GIFT: 0.942 mg
Seed mass max1.3 mg
Seed mass min0.765 mg
Life cycle & reproduction13
Deciduousnessevergreen
Dispersal typeanimal
Flowering endSep
Flowering startJun
Life formperennial
Life spanperennial
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number69 732
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max500 m
Elevation min0 m
Epiphyteterrestrial
Fruit typemericarp
Growth formherb
Habitat GIFTLowland
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)270 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)29.8 mm²/mg
Other traits1
Diaspore typeunknown
03Chemical composition86 compounds
Compounds documented for Leonurus cardiaca across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
💊 Medicinal use documented
Compound class profile5 classes
Guaiane sesquiterpenoids10
Flavonols7
Labdane diterpenoids4
Unsaturated fatty acids4
Cinnamic acids and derivatives $ Phenylethanoids4
Documented compounds86 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| FAT | 302,000 ppm | DukesPhytochem | |
| PROTEIN | 223,000 ppm | DukesPhytochem | |
| TANNIN | 90,000 ppm | DukesPhytochem | |
| ALKALOIDS | 3,500 ppm | DukesPhytochem | |
| EO | 500 ppm | DukesPhytochem | |
| CARYOPHYLLENE | 200 ppm | DukesPhytochem | |
| ALPHA-HUMULENE | 175 ppm | DukesPhytochem | |
| ASCORBIC-ACID | 42 ppm | DukesPhytochem | |
| ALPHA-PINENE | 28 ppm | DukesPhytochem | |
| LINALOL | 4 ppm | DukesPhytochem |
05DNA & barcoding37 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Leonurus cardiaca has left across the world's sequence archives.
At a glance
DNA specimens37
Marker genes10
GenBank sequences10
eDNA detections20
Countries6
The DNA barcodea real sequence read deposited for this species
AAAGCAGACCGCGAACACGTACGAAACAACCCCCGGGGCGGCGTTGGGGGGGCAACCTCCCAATGCGGCCCCGAACCCGTCGGTGCGCGC …
Leonurus cardiaca voucher 202206029 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★matK-like★rbcL4★rbcLa★ITS3★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Leonurus cardiaca carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size833 745 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Leonurus cardiaca0.83 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records18–182n range18median18mode31records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1831×CCDB · slov-fl · CCDB · brit-fl · CCDB · nw-europe-fl +10
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · brit-fl — Rutland, J.P. New Phytol. 40: 210-214 (1941)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3468
CCDB · fl-europaea — Polya, 1949
CCDB · poland — Pogan E., Wcis?o H., Jankun A. et al. 1980 b. Further studies in chromosome numbers of Polish Angiosperms. Part XIII. Acta Biol. Cracov. Ser. Bot. 22, 37-69.
CCDB · ipcn-api-dl — Sekovski, Z. & M. Jovanovska. 1983. Chromosome atlas of some Macedonian angiosperms. IV. Ann. Fac. Biol. Univ. Skopje. 36: 73–86.
CCDB · ipcn-api-dl — Gill, L. S. 1981. Chromosomal evolution and incidence of polyploidy in the Canadian Labiatae. Rev. Cytol. Biol. Vég., Bot. 4: 331–339.
CCDB · ipcn-api-dl — Krasnikov, A. A. & D. N. Schaulo. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. II. Bot. Žhurn. (Moscow & Leningrad) 75: 118–120.
CCDB · ipcn-api-dl — Baltisberger, M. 1991. IOPB chromosome data 3. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 17: 5–7.
CCDB · ipcn-api-dl — Murín, A. 1997. Karyotaxonomy of some medicinal and aromatic plants. Thaiszia 7: 75–88.
CCDB · ipcn-api-dl — Pogan, E., H. Wcislow & A. Jankun. 1980. Further studies in chromosome numbers of Polish Angiosperms Part XlIl. Acta Biol. Cracov., Ser. Bot. 22: 37–69.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Lippert. 2006. Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten. Ber. Bayer. Bot. Ges. 76: 85–110.
CCDB · book-ipcn72 — MARKOWA, M. & P. IWANOWA. 1972. Karyologische Untersuchung der vertreter der Fam. Boraginaceae, Labiatae und scrophulariaceae in Bulgarien. Izv. Bot. Inst. (Sofia) 22: 149-157.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-ipcn67-71 — MARKOVA, M.L., & P. ST. IVANOVA. 1971. In IOPB chromosome reports XXXIII. Taxon 20: 609-614.
CCDB · book-ipcn73-74 — PODLECH, D., & o. BADER. 1974. Chromosomenstudien an Afghanischen Pflanzen II. Mitt. Bot. Mtinchen 11; 457-488.
CCDB · book-indian_vol1 — Wulff, H.D. 1939a ; Rutland, J.P. 1941 ; Tarnavschi, I.T. 1948 ; Polya, L. 1949 ; Mulligan, G.A. (Fedorov); Murin & Uhrikova (Fedorov) ; Gill, L.S. 1970; Majovsky, J. et al. 1970a; Markova, M.L. & Ivanova, P.St. 1971 ; Markowa, M. & Iwanowa, P. 1972 ; Morton, J.K.l973
CCDB · book-fedorov — Wulff 1939a
CCDB · book-fedorov — Rutland
CCDB · book-fedorov — Tarnavschi 1948
CCDB · book-fedorov — P6lya 1949
CCDB · book-fedorov — Mulligan 1961
CCDB · book-fedorov — Murin, Uhrikova
CCDB · book-fedorov — I. Slov. fl. I. 1967)
CCDB · book-atlas-flowering-plants — Rutland 1941
CCDB · CromoCat 2015 — Markova, M. L. & Ivanova, P. S. (1971a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXIII]. Taxon 20(4): 611.
CCDB · CromoCat 2015 — Baltisberger, M. (1991b). IOPB Chromosome Data 3 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 17: 5-7.
CCDB · CromoCat 2015 — Uhríková, A. & J. Májovsky. (1977). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVI]. Taxon 26(2/3): 263.
CCDB · CromoCat 2015 — Lippert, W. (2006). Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten Ber. Bayer. Bot. Ges. 76: 85–110
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786
n 912×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · ipcn-api-dl — Gill, D. E. 1983. Within tree variation in fruit production and seed set in Capparis odoratissima Jacó in Costa Rica. Brenesia 21: 33–40.
CCDB · ipcn-api-dl — Saggoo, M. I. 1983. Cytomorphological studies on plants of economic importance of Bicarpellatae from India. 259 pp.
CCDB · ipcn-api-dl — Bir, S. S. & M. I. S. Saggoo. 1984. Cytological studies on the family Labiatae from Gharwal Himalayas. In: G.S. Paliwal (editor), The Vegetational Wealth of the Himalayas. pp. 471–482.
CCDB · ipcn-api-dl — Gill, L. S. 1984. The incidence of polyploidy in the West-Himalayan Labiatae. Rev. Cytol. Biol. Vég., Bot. 7: 5–16.
CCDB · ipcn-api-dl — Gill, L. S. 1981. Chromosomal evolution and incidence of polyploidy in the Canadian Labiatae. Rev. Cytol. Biol. Vég., Bot. 4: 331–339.
CCDB · ipcn-api-dl — Hill, L. M. 1989. IOPB chromosome data 1. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 13: 17–19.
CCDB · ipcn-api-dl — Pogan, E., H. Wcislow & A. Jankun. 1980. Further studies in chromosome numbers of Polish Angiosperms Part XlIl. Acta Biol. Cracov., Ser. Bot. 22: 37–69.
CCDB · book-ipcn67-71 — GILL, L.S. 1970. Cytological observations on West-Himalayan Labiatae: Tribe Stachydeae. Phyton (Buenos Aires) 27: 177-184.
CCDB · CromoCat 2015 — Kaur, D. & Singhal, V. K. (2010). IAPT/IOPB Chromosome Data 9 Taxon 59 (4): 1300-1301
CCDB · CromoCat 2015 — Hill, L. M. (1989). IOPB Chromosome Data 1 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 13: 17-19.
CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~0.35 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin0.35 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type65 640 records
Wild obs. + sensor60 877
Museum / vouchered4 643
Cultivated / captive41
Fossil1
Other78
Origin
Native4
Introduced354
Range
Area of Occupancy AOO130 548 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy74% within 1 km
≤100 m 33 104≤1 km 4 476≤10 km 12 229>10 km 1 287
51 096 georeferenced · 9 781 without coordinates
Open the mapobservation + sensor60 877
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy35% within 1 km
≤100 m 161≤1 km 870≤10 km 1 711>10 km 169
2 911 georeferenced · 1 732 without coordinates
Open the institutions mapphysical evidence4 643
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy7% within 1 km
≤1 km 2≤10 km 14>10 km 12
28 georeferenced · 13 without coordinates
Open the mapnot free-living41
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions147 of 256 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 531 |
| Philadelphia, US | 244 |
| Madison, US | 208 |
| Chongqing Museumlocation not on record | 160 |
| BFLlocation not on record | 148 |
| MeiseBGlocation not on record | 133 |
| Uppsala, SE | 112 |
| Uniwersytet Warszawskilocation not on record | 110 |
| Wuzhou, CN | 103 |
| Adam Mickiewicz University in Poznańlocation not on record | 88 |
| Olocation not on record | 80 |
| Bloomington, US | 72 |
| Kuopio, FI | 72 |
| Bronx, US | 67 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 67 |
| Québec, CA | 64 |
| Oskarshamn, SE | 60 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 53 |
| Ann Arbor, US | 51 |
| Görlitz, DE | 51 |
| SLU Artdatabankenlocation not on record | 43 |
| New Haven, US | 38 |
| Burlington, US | 35 |
| GJOlocation not on record | 35 |
| Saint Louis, US | 33 |
| McWane Science Centerlocation not on record | 32 |
| University of New Hampshirelocation not on record | 31 |
| Flagstaff, US | 31 |
| CJBGlocation not on record | 31 |
| Wlocation not on record | 30 |
| LDlocation not on record | 29 |
| Allentown, US | 26 |
| Chadron, US | 25 |
| Bern, CH | 25 |
| Green Bay, US | 24 |
| College Park, US | 24 |
| Zürich, CH | 23 |
| Zürich, CH | 23 |
| Turku, FI | 22 |
| TUR-Alocation not on record | 22 |
| Denver, US | 22 |
| Trondheim, NO | 21 |
| Tallinn, EE | 21 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 20 |
| BIO-UNIPIlocation not on record | 19 |
| Uniwersytet Śląski w Katowicachlocation not on record | 18 |
| Whitewater, US | 18 |
| Toronto, CA | 18 |
| ASUlocation not on record | 18 |
| South Kensington, GB | 18 |
| Oulu, FI | 17 |
| Williamsburg, US | 16 |
| Salzburg, AT | 16 |
| University of Stellenboschlocation not on record | 16 |
| Albuquerque, US | 16 |
| Philadelphia, US | 15 |
| Bangkok, TH | 15 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 15 |
| Bozeman, US | 14 |
| BRNUlocation not on record | 13 |
| US | 13 |
| Tartu, EE | 13 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 12 |
| Université Lavallocation not on record | 12 |
| Bergen, NO | 12 |
| Christchurch, NZ | 12 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 12 |
| Chicago, US | 12 |
| Acadia Universitylocation not on record | 11 |
| Moscow State Universitylocation not on record | 11 |
| Waverly, US | 11 |
| Saint John, CA | 10 |
| Dekalb, US | 10 |
| BSBIlocation not on record | 10 |
| PRClocation not on record | 10 |
| Spearfish, US | 10 |
| Jyväskylä, FI | 9 |
| Mlocation not on record | 9 |
| Helsinki, FI | 9 |
| Chengdu, CN | 9 |
| Berlin, DE | 9 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 9 |
| Emporia, US | 9 |
| Dresden, DE | 9 |
| Columbia, US | 8 |
| Keene State Universitylocation not on record | 8 |
| MAlocation not on record | 8 |
| Montréal, CA | 8 |
| St. Paul, US | 8 |
| US | 8 |
| Mississippi State, US | 7 |
| Pullman, US | 7 |
| Natural History Museum Rotterdamlocation not on record | 7 |
| Museum of the Rockieslocation not on record | 6 |
| Little Rock, US | 6 |
| Missoula, US | 6 |
| University of Guelph, OAC Herbariumlocation not on record | 6 |
| DOI/NPS, Greenbelt Parklocation not on record | 6 |
| Davenport, US | 6 |
| Staten Island, US | 6 |
| Philadelphia, US | 6 |
| Córdoba, AR | 6 |
| LfUlocation not on record | 6 |
| KIRMlocation not on record | 6 |
| Hudson, US | 5 |
| Wellington, NZ | 5 |
| KMNlocation not on record | 5 |
| Fayetteville, US | 5 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 5 |
| TROMlocation not on record | 5 |
| No collectionlocation not on record | 5 |
| Regensburgische Botanische Gesellschaftlocation not on record | 5 |
| Kew, GB | 5 |
| Millersville, US | 5 |
| Lord Fairfax Community Collegelocation not on record | 4 |
| Nijmegen, NL | 4 |
| Fulda, DE | 4 |
| Moscow, US | 4 |
| IDElocation not on record | 4 |
| Durham, US | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Lincoln, US | 4 |
| Pittsburg, US | 4 |
| Tilburg, NL | 4 |
| Logan, US | 4 |
| Provincia di Livornolocation not on record | 4 |
| Northridge, US | 4 |
| Corvallis, US | 4 |
| Chicago, US | 4 |
| UGentlocation not on record | 4 |
| Minia, EG | 4 |
| Chapel Hill, US | 3 |
| Fargo, US | 3 |
| Provo, US | 3 |
| Boise, US | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Beijing, CN | 3 |
| Barcelona, ES | 3 |
| Science Museum of Minnesotalocation not on record | 3 |
| Bourges, FR | 3 |
| Claremont, US | 3 |
| BAYLUlocation not on record | 3 |
| Otaru, JP | 3 |
| Porrentruy, CH | 3 |
| Podgorica, ME | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Kingston, US | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| Washington, US | 3 |
| Jena Microbial Resource Collectionlocation not on record | 3 |
| WTUlocation not on record | 3 |
| Frankfurt am Main | 3 |
| Mexico City, MX | 3 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Orem, US | 2 |
| Victoria, CA | 2 |
| FLADlocation not on record | 2 |
| Ypsilanti, US | 2 |
| Montréal, CA | 2 |
| Sendai, JP | 2 |
| University of South Dakotalocation not on record | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Paris, FR | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Asheville, US | 2 |
| Macomb, US | 2 |
| WINlocation not on record | 2 |
| Norfolk, US | 2 |
| Kirksville, US | 2 |
| JBSlocation not on record | 2 |
| Cheney, US | 2 |
| Fairfax, US | 2 |
| BClocation not on record | 2 |
| Vancouver, CA | 2 |
| Meguro Parasitological Museumlocation not on record | 2 |
| Phoenix, US | 2 |
| Auckland, NZ | 2 |
| Smithsonian Institutionlocation not on record | 2 |
| AUAlocation not on record | 1 |
| Xiamen, CN | 1 |
| Hazara Universitylocation not on record | 1 |
| University of Wisconsinlocation not on record | 1 |
| GAlocation not on record | 1 |
| Brussel, BE | 1 |
| Caldwell, US | 1 |
| Castelar, AR | 1 |
| Durango, MX | 1 |
| Cambridge, US | 1 |
| CJBNlocation not on record | 1 |
| ROM020location not on record | 1 |
| Turlock, US | 1 |
| Knoxville, US | 1 |
| POL003location not on record | 1 |
| Mount Annan, AU | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Mérida, MX | 1 |
| San Luis Obispo, US | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Dipartimento di Scienze della Vita dell'Università degli Studi di Trieste | Department of Life Sciences of the University of Triestelocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| San Diego, US | 1 |
| ROM007location not on record | 1 |
| Salvador, BR | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| BDBClocation not on record | 1 |
| Boumlocation not on record | 1 |
| Tuscaloosa, US | 1 |
| Uniwersytet w Białymstokulocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Miami, US | 1 |
| Long Beach, US | 1 |
| nbflocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| NTNU University Museum, Department of Natural Historylocation not on record | 1 |
| València, ES | 1 |
| Brookings, US | 1 |
| Riverside, US | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Lausanne, CH | 1 |
| Weber State Universitylocation not on record | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| Riyadh Municipalitylocation not on record | 1 |
| San Angelo, US | 1 |
| Pondicherry, IN | 1 |
| LINUlocation not on record | 1 |
| UIBlocation not on record | 1 |
| Frauenfeld, CH | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Shanghai, CN | 1 |
| Tapachula, MX | 1 |
| Rotorua, NZ | 1 |
| Whitehorse, CA | 1 |
| Karlsruhe, DE | 1 |
| FLASlocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| USFS/BHSClocation not on record | 1 |
| Guilin, CN | 1 |
| EL PASO, US | 1 |
| Göteborg, SE | 1 |
| Hobart, AU | 1 |
| BG-NMNHSlocation not on record | 1 |
| Edinburgh, GB | 1 |
| Dehra Dun, IN | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
| Tampa, US | 1 |
| LPMMBHlocation not on record | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Sion, CH | 1 |
| USFSlocation not on record | 1 |
| Canberra, AU | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
256 institutions · 4 104 of 4 643 vouchered records shown · 486 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA20 detections
Where the DNA of Leonurus cardiaca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map6 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.2 °C 13.5–21.9
Seasonal swing summer↔winter23.9 °C
Max temp (day)22.8 °C 16.7–26.5
Min temp (night)13.8 °C 10.8–17.6
Precipitation90.1 mm/mo 79.0–101
Air humidity59.6 % 56.9–62.2
Moisture balance-43.0 mm/mo -62.9–18.9
Vapour deficit878 Pa 608–1,087
Wind speed3.40 m/s 2.50–4.20
Cloud cover43.7 % 34.6–50.6
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.