Leonotis nepetifolia
(L.) R.Br. · speciesAt a glance
Occurrence records11 520
Data sources13
Biological traits42
DNA specimens24
eDNA detections11
Sources13 archives
Databases and archives Leonotis nepetifolia's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility11 520 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics24 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources42 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS37 compounds
Occurrence & distributionGBIF11 520 records
Environmental DNA1 datasets · 3 countries11 detections
DNA & barcodingBOLD · NCBI24 specimens
Genome at a glanceCCDB · GIFT2n = 28
01Narrative
Leonotis nepetifolia est une espèce de plantes à fleurs dicotylédones de la famille des Lamiaceae (Labiateae), sous-famille des Lamioideae, originaire des régions tropicales et subtropicales d'Afrique subsaharienne et du sous-continent indien. Ce sont des plantes herbacées annuelles à port dressé, pouvant atteindre 3 mètres de haut aux feuilles simples, opposées, et aux fleurs orange nombreuses groupées en verticilles. L'espèce a été introduite dans diverses régions du monde, en particulier en Australie et dans les îles du Pacifique, en Amérique centrale et en Amérique du Sud, en Afrique du Nord, en Chine et en Asie du Sud-Est où elle s'est souvent naturalisée et est parfois considérée comme une plante envahissante, notamment en Australie, dans l'archipel de Hawaï, en Floride. Cette espèce a différents usages en médecine traditionnelle tant en Afrique qu'en Inde. Selon certaines études pharmacologiques, basées sur les revendications traditionnelles, Leonotis nepetifolia des activités anticonvulsivantes, antinociceptives, anti-inflammatoires, antidiabétiques, anthelminthiques et hypoglycémiantes. C'est également une plante appréciée pour ses qualités ornementales.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology13
Fruit length max5.5 mm
Fruit length min2.5 mm
Leaf length max160 mm
Leaf length min45 mm
Leaf width60 mm
Leaf width max60 mm
Leaf width min20 mm
Plant height1.75 m
⚠ sources differ — GIFT: 1.75 m · AusTraits: 3 m
Plant height max3 m
Plant height min0.6 m
Seed mass1.81 mg
Seed mass max2.64 mg
Seed mass min0.4 mg
Life cycle & reproduction11
Dehiscenceindehiscent
Dispersal typeunspecialized
Flower colourorange
Flower length max25 mm
Flowering endAug
Flowering startJun
Life formannual, perennial or subshrub
Life spanannual
⚠ sources differ — TRY: Annual · AusTraits: annual perennial · GIFT: annual
Pollination modebiotic
Pollination syndrome detailedbee
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 900 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourbrown
Fruit typeachene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb shrub · TRY: Herb
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Carrasco, Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta de Várzea, Floresta Ombrófila (= Floresta Pluvial), Restinga
Leaf formelliptic
Woodinessvariable
⚠ sources differ — TRY: non-woody/woody · AusTraits: herbaceous woody · GIFT: non-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Other traits3
Leaf arrangementopposite
Seeds per fruit1-10
Shoot orientationerect
03Chemical composition37 compounds
Compounds documented for Leonotis nepetifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
💊 Medicinal use documented
Compound class profile4 classes
Iridoids monoterpenoids3
Labdane diterpenoids3
Cinnamic acids and derivatives $ Phenylethanoids3
Tetracyclic diterpenoids1
Documented compounds37 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| FAT | 380,000 ppm | DukesPhytochem | |
| CARBOHYDRATES | 368,000 ppm | DukesPhytochem | |
| PROTEIN | 288,000 ppm | DukesPhytochem | |
| OLEIC-ACID | 245,480 ppm | DukesPhytochem | |
| FIBER | 157,000 ppm | DukesPhytochem | |
| ASH | 65,000 ppm | DukesPhytochem | |
| (-)-5,6-OCTADECADIENIC-ACID | 60,800 ppm | DukesPhytochem | |
| LABALLENIC-ACID | 60,800 ppm | DukesPhytochem | |
| PALMITIC-ACID | 45,600 ppm | DukesPhytochem | |
| LINOLEIC-ACID | 45,220 ppm | DukesPhytochem |
05DNA & barcoding24 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Leonotis nepetifolia has left across the world's sequence archives.
At a glance
DNA specimens24
Marker genes5
GenBank sequences10
eDNA detections11
Countries3
The DNA barcodea real sequence read deposited for this species
GGGTGTTAAAGAGTACAAATTGACTTATTATACCCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCA …
Leonotis nepetifolia ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL5★rbcLa★trnL-FtrnH-psbA
plant barcodemarker
06Genome at a glanceCCDB · GIFT
The complete instruction manual Leonotis nepetifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidydiploid inferred
Chromosome records24–282n range28median28mode13records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 287×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · book-fedorov +2
CCDB · ipcn-api-dl — Morton, J. K. 1993. Chromosome numbers and polyploidy in the flora of Cameroon Mountain. Opera Bot. 121: 159–172.
CCDB · book-indian_vol1 — Morton, J.K. 1962 ; Pal, M. 1964 ; Pal, S. 1971
CCDB · book-fedorov — Morton J. K. 1962
CCDB · book-fedorov — Pal M. 1964
CCDB · Cave1962 — Morton 1962
GIFT · GIFT (floras)
2n 245×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · Cave1963 +1
CCDB · ipcn-api-dl — Vembu, B. 1984. On the chromosome numbers of some members of Lamiaceae. Proc. Indian Sci. Congr. Assoc. 71(3–VI): 80–81.
CCDB · ipcn-api-dl — Vembu, B. & K. R. Ayyangar. 1986. Karyological characteristics of Hyptis suaveolens (L.) Poit. and Leonotis nepetifolia (L.) R. Br. Proc. Indian Sci. Congr. Assoc. 73(3–VI): 156–157.
CCDB · book-fedorov — Miege 1960b
CCDB · Cave1963 — Mi°ege 1960
GIFT · GIFT (floras)
2n 261×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 132×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Saggoo, M. I. 1983. Cytomorphological studies on plants of economic importance of Bicarpellatae from India. 259 pp.
CCDB · ipcn-api-dl — Saggoo, M. I. & S. S. Bir. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 593–595.
n 141×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — Sharma 1970
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=0.144 ↗
08Occurrence & distribution
Record type11 520 records
Wild obs. + sensor9 506
Museum / vouchered2 003
Cultivated / captive1
Other10
Origin
Native1
Introduced326
Range
Area of Occupancy AOO20 952 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy88% within 1 km
≤100 m 4 957≤1 km 1 228≤10 km 643>10 km 230
7 058 georeferenced · 2 448 without coordinates
Open the mapobservation + sensor9 506
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy79% within 1 km
≤100 m 429≤1 km 81≤10 km 106>10 km 33
649 georeferenced · 1 354 without coordinates
Open the institutions mapphysical evidence2 003
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions114 of 248 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 141 |
| Durango, MX | 112 |
| Bronx, US | 91 |
| Brisbane, AU | 67 |
| Mexico City, MX | 60 |
| Pretoria, ZA | 52 |
| Kew, GB | 50 |
| Laboratorio de Ictiologialocation not on record | 45 |
| Austin, US | 43 |
| Chapingo, MX | 39 |
| Mérida, MX | 35 |
| Tampa, US | 34 |
| Feira de Santana, BR | 32 |
| Baroda, IN | 32 |
| Chicago, US | 32 |
| Juriquilla, MX | 31 |
| UNIVASFlocation not on record | 29 |
| Culiacán, MX | 25 |
| UFBAlocation not on record | 23 |
| Chaguaramas, TT | 22 |
| Palmerston, AU | 22 |
| Masindi, UG | 17 |
| LDlocation not on record | 15 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 15 |
| Riverside, US | 15 |
| Universidad de Antioquia (UdeA)location not on record | 14 |
| Adam Mickiewicz University in Poznańlocation not on record | 14 |
| Istituto Agrario Castelnuovolocation not on record | 14 |
| Universidade Federal de Sergipe (UFS)location not on record | 14 |
| University of Stellenboschlocation not on record | 13 |
| León, NI | 11 |
| Cenargenlocation not on record | 11 |
| Ciudad de México, MX | 11 |
| Castelar, AR | 11 |
| Mexico City, MX | 11 |
| Mount Annan, AU | 11 |
| Paleontological Collectionlocation not on record | 11 |
| Chongqing Museumlocation not on record | 10 |
| JBRJlocation not on record | 10 |
| Brasília, BR | 10 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 9 |
| Smithfield, AU | 9 |
| UTFPR-CPlocation not on record | 9 |
| UNESP-ISlocation not on record | 9 |
| Universidad de Nariño (UdeNar)location not on record | 9 |
| UFMSlocation not on record | 9 |
| Campo Mourão, BR | 9 |
| Canberra, AU | 8 |
| MeiseBGlocation not on record | 8 |
| Museo Entomologico de Leonlocation not on record | 8 |
| Puebla, MX | 8 |
| Toluca, MX | 8 |
| FUNEDlocation not on record | 8 |
| Zacatecas, MX | 8 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 7 |
| Honolulu, US | 7 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 7 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 7 |
| St. Augustine, TT | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| San Diego, US | 7 |
| Salvador, BR | 7 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 7 |
| Austin, US | 7 |
| Dresden, DE | 7 |
| Maringá, BR | 7 |
| ASUlocation not on record | 6 |
| Pondicherry, IN | 6 |
| UFRPElocation not on record | 6 |
| BISHlocation not on record | 6 |
| Uppsala, SE | 6 |
| Universidad Nacional de Colombia (UNAL)location not on record | 6 |
| Tapachula, MX | 6 |
| UEMlocation not on record | 6 |
| Altos de Pipe, VE | 6 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 6 |
| Tuscaloosa, US | 6 |
| URCAlocation not on record | 5 |
| Departamento de Sistematica e Ecologialocation not on record | 5 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 5 |
| SLU Artdatabankenlocation not on record | 5 |
| Valdosta State Universitylocation not on record | 5 |
| Foz do Iguaçu, BR | 5 |
| UnBlocation not on record | 5 |
| Fortaleza, BR | 5 |
| Guasave, MX | 5 |
| Xiamen, CN | 5 |
| UESBlocation not on record | 4 |
| Corrientes, AR | 4 |
| San Isidro, AR | 4 |
| Federal University of Espírito Santolocation not on record | 4 |
| UNICAMPlocation not on record | 4 |
| UFERSAlocation not on record | 4 |
| UFPIlocation not on record | 4 |
| Universidade Federal do Espírito Santolocation not on record | 4 |
| Brasília, BR | 4 |
| Universidad Industrial de Santander (UIS)location not on record | 4 |
| Universidad de La Salle (La Salle)location not on record | 4 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 4 |
| Wuzhou, CN | 4 |
| UFESlocation not on record | 4 |
| Ilhéus, BR | 4 |
| Ivano-Frankivsk, UA | 4 |
| Blumenau, BR | 4 |
| Tlalnepantla, MX | 4 |
| Columbia, US | 4 |
| Autlán de Navarro, MX | 4 |
| Jena Microbial Resource Collectionlocation not on record | 4 |
| Antiguo Cuscatlán, SV | 3 |
| National Biodiversity Institute, Costa Ricalocation not on record | 3 |
| Mexico City, MX | 3 |
| Christchurch, NZ | 3 |
| INBIOlocation not on record | 3 |
| San Francisco de Campeche, MX | 3 |
| UFOPlocation not on record | 3 |
| UEMAlocation not on record | 3 |
| BAYLUlocation not on record | 3 |
| Adelaide, AU | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 3 |
| CJBGlocation not on record | 3 |
| Kensington, AU | 3 |
| EL PASO, US | 3 |
| Stockholm, SE | 3 |
| Londrina, BR | 3 |
| Universidade Federal do Maranhãolocation not on record | 3 |
| UFRRJlocation not on record | 3 |
| San Luis Potosí, MX | 3 |
| MAlocation not on record | 3 |
| UTPLlocation not on record | 3 |
| Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record | 3 |
| South Kensington, GB | 2 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 2 |
| Criciúma, BR | 2 |
| Bloomington, US | 2 |
| Montréal, CA | 2 |
| UFMGlocation not on record | 2 |
| MEXUlocation not on record | 2 |
| Cascavel, BR | 2 |
| Auckland, NZ | 2 |
| Hermosillo, MX | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| Córdoba, AR | 2 |
| Arusha, TZ | 2 |
| Bangkok, TH | 2 |
| AUAlocation not on record | 2 |
| Giardini Botanici Hanburylocation not on record | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Santa Teresa, BR | 2 |
| UFSClocation not on record | 2 |
| UNEMATlocation not on record | 2 |
| Universidad Nacional de Asunciónlocation not on record | 2 |
| PUC-RSlocation not on record | 2 |
| Denver, US | 2 |
| La Paz, MX | 2 |
| CASlocation not on record | 2 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 2 |
| Claremont, US | 2 |
| TAFORI-LSRClocation not on record | 2 |
| University of Johannesburglocation not on record | 2 |
| Berlin, DE | 2 |
| Seropédica, BR | 2 |
| Plocation not on record | 2 |
| USP-IBlocation not on record | 2 |
| Centro de Investigaciones Biológicas, Universidad Autónoma del Estado de Hidalgolocation not on record | 2 |
| INMAlocation not on record | 2 |
| Leiden University Medical Centerlocation not on record | 2 |
| UNESClocation not on record | 2 |
| Universidad de Caldas (UCaldas)location not on record | 2 |
| Aarhus, DK | 2 |
| CPATSAlocation not on record | 2 |
| Durban, ZA | 2 |
| University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record | 1 |
| LBVlocation not on record | 1 |
| Fort Worth, US | 1 |
| UFVJMlocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Edinburgh, GB | 1 |
| Bogotá, D.C., CO | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| Morelia, MX | 1 |
| Lake Charles, US | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Santiago de Cali, CO | 1 |
| WAGlocation not on record | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Quito, EC | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
| Vietnam Academy of Science and Technology (VAST)location not on record | 1 |
| Rotorua, NZ | 1 |
| EAlocation not on record | 1 |
| Santa Barbara, US | 1 |
| Herbier National du Gabonlocation not on record | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| Universidad de Pamplona (UPamplona)location not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| San José, CR | 1 |
| New Mexico State Universitylocation not on record | 1 |
| Universidade de São Paulolocation not on record | 1 |
| National Museums of Kenyalocation not on record | 1 |
| Lubbock, US | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Cape Town, ZA | 1 |
| CMULlocation not on record | 1 |
| Anchorage, US | 1 |
| UNISANTAlocation not on record | 1 |
| Barcelona, ES | 1 |
| Dekalb, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| UNESP-IBILCElocation not on record | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| Zlocation not on record | 1 |
| Cuiabá, BR | 1 |
| Sri Ramaswamy Memorial Universitylocation not on record | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| IPA/SPlocation not on record | 1 |
| Addis Ababa, ET | 1 |
| Pelotas, BR | 1 |
| MSB-2797location not on record | 1 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 1 |
| DSMlocation not on record | 1 |
| Ensenada, MX | 1 |
| HUAlocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
| NHMJlocation not on record | 1 |
| Provo, US | 1 |
| Chapel Hill, US | 1 |
| Vancouver, CA | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| National Herbarium of São Tomé and Principelocation not on record | 1 |
| Jinghong, CN | 1 |
| CNF-UFHBlocation not on record | 1 |
| Davis, US | 1 |
| Loja, EC | 1 |
| UEPAlocation not on record | 1 |
| Paris, FR | 1 |
| HNBlocation not on record | 1 |
| ESALQlocation not on record | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
248 institutions · 1 886 of 2 003 vouchered records shown · 117 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA11 detections
Where the DNA of Leonotis nepetifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found11
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 11 detections have coordinates
Open the map3 countries0
Red soil savanna bushland.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.2 °C 18.5–22.2
Seasonal swing summer↔winter5.40 °C
Max temp (day)24.5 °C 23.4–27.8
Min temp (night)13.6 °C 13.1–16.8
Precipitation57.8 mm/mo 14.9–73.1
Air humidity56.6 % 53.7–56.9
Moisture balance-73.5 mm/mo -76.4–-56.8
Vapour deficit983 Pa 913–1,245
Wind speed2.50 m/s 1.80–2.50
Cloud cover30.9 % 14.0–36.5
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.