Lehmannia marginata

(O.F.Müller, 1774) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Stylommatophora/Limacidae/Lehmannia

At a glance

Occurrence records22 896

Data sources7

Biological traits2

DNA specimens155

eDNA detections10

Sources7 archives

Databases and archives Lehmannia marginata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility22 896 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics155 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF22 896 records

Environmental DNA1 datasets · 0 countries10 detections

DNA & barcodingBOLD155 specimens

01Narrative

A small Lehmannia marginata browsing on lichen amid moss patches Lehmannia marginata is a species of air-breathing land slug, a terrestrial pulmonate gastropod mollusk in the family Limacidae. Sometimes classified in the genus Limax, the species is distinct in its ecology, and its nearly transparent body. It is a medium-sized species, rarely exceeding 12 cm in body length. The body is fairly long and narrow, with a marked keel. The keel looks lighter than the remaining body against the darker innards.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding155 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lehmannia marginata has left across the world's sequence archives.

At a glance

DNA specimens155

BINs5

Marker genes2

eDNA detections10

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus139 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 45 variable positions, in barcode order

34Amostly conserved

38Gmostly conserved

40Tmostly conserved

49Amostly conserved

56Tmostly conserved

59Tmostly conserved

68Tmostly conserved

74Cmostly conserved

79Gmostly conserved

85Cmostly conserved

127Cmostly conserved

133Tmostly conserved

142Tmostly conserved

157Gmostly conserved

169Cmostly conserved

172Amostly conserved

190Tmostly conserved

193Amostly conserved

202Tmostly conserved

265Cvariable

274Gmostly conserved

313Tvariable

337Cmostly conserved

340Cmostly conserved

346Amostly conserved

361Amostly conserved

370Amostly conserved

379Tmostly conserved

406Amostly conserved

412Tmostly conserved

430Gmostly conserved

463Amostly conserved

475Amostly conserved

496Gmostly conserved

499Amostly conserved

508Gmostly conserved

532Amostly conserved

538Amostly conserved

544Amostly conserved

559Cvariable

565Tmostly conserved

613Tmostly conserved

616Tmostly conserved

625Gvariable

628Gmostly conserved

AACTTTATATATAATTTTTGGGGTGTGGTGTGGAATAGTTGGAACTGGACTATCATTATTAATTCGATTGGAGCTAGGGACAGCCGGTGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes33

BINs5

Most divergent pair14.8%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lehmannia carpaticasame genus3.8%Limacus maculatussame family12.2%Bielzia coerulanssame family12.5%Glyphyalinia indentatasame order13.0%Coneuplecta calculosasame order13.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type22 896 records

Wild obs. + sensor19 014

Museum / vouchered3 847

Fossil1

Other34

Origin

Native956

Range

Area of Occupancy AOO47 476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 6 839≤1 km 3 157≤10 km 7 282>10 km 161

17 439 georeferenced · 1 575 without coordinates

Open the mapobservation + sensor19 014

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 240≤1 km 100≤10 km 807>10 km 21

1 168 georeferenced · 2 679 without coordinates

Open the institutions mapphysical evidence3 847

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Gothenburg, SE	2 558
Paro, BT	336
Bern, CH	292
SLU Artdatabankenlocation not on record	177
Helsinki, FI	55
Barcelona, ES	34
Universität Zürich, Naturhistorisches Museumlocation not on record	30
BioFokuslocation not on record	30
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	28
NNMLlocation not on record	14
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	13
Provincia di Livornolocation not on record	12
Tromsø, NO	11
Dhaka, BD	9
SNSDlocation not on record	9
Frankfurt am Main	8
Musee d'Histoire Naturallelocation not on record	7
DASSHlocation not on record	4
Salzburg, AT	3
ZSMlocation not on record	3
South Kensington, GB	2
Geneva, CH	2
Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record	2
Metsähallituslocation not on record	2
Bavarian State Collection of Zoologylocation not on record	1
Chicago, US	1
MZLUlocation not on record	1
Philadelphia, US	1
Victoria, CA	1

29 institutions · 3 646 of 3 847 vouchered records shown · 201 without an institution code

09Environmental DNA10 detections

Where the DNA of Lehmannia marginata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Lehmannia marginata

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type22 896 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type22 896 records